This was followed by the Ilocos Region Office's ARISEP-Agno River Irrigation System Project (75 contracts, 
P870 million), projects in the Davao Region (30 contracts, P818.4 million), Balog-Balog Multipurpose Project (eight contracts, P392.9 million), and projects in Bicol Region (45 contracts, P366.3 million).
Also incomplete were 75 more contracts amounting to 
P870.025 million in connection with the Agno River Irrigation System Extension Project in Pangasinan, and eight contracts amounting to P392.937 million as part of the Balog-Balog Multi-Purpose Project in Tarlac.
The remittance account's unreconciled to date, he said, had been substantially reduced and the amounts stand at 
P870 million for payments and P10.75 billion for receipts.
The six-speed manual Accent CRDi GL is priced at 
P870,000, while the automatic diesel Accent starts at P998,000.
Primers Sequence (5'-3') P231 acgcagaaggcaatgtcatacc P637 aatccacatcggccagatcg P869 aaggacatgatgctatggctgg 
P870 ggaagaacagtatgtcgagc P1217 ccggatcaagagctaccaac P1238 gagttggtagctcttgatcc P1668 gccacctctgacttgagcgt P2100 ccgctcacaattccacacaa P2510 gaagtccagctgccagaaac P2958 ggtctgcaccatcgtcaacc P3478 cggcgagttctgttaggtcc P3937 ggagctgcatgtgtcagagg P3956 cctctgacacatgcagctcc Table 2.
The PSC pays $17,000 (roughly 
P870,000) in yearly membership dues to Wada to monitor national athletes for banned substances in the course of their training and participation in individual and multisports events under the aegis of the international Olympic Committee (IOC).
Dulay said the agen-cy's Large Taxpayers Service (LTS) continues to perform well with a total take of almost 
P870 billion from January to August, seven percent more than the actual col-lection for the same pe-riod last year.
Seized from Maniwang were five large packs of suspected shabu which weighed 128 grams with an estimated value of 
P870,000.
A franchisee has to pay P1.12 million in total fees only with a monthly sales quota of 
P870,000.