Medical

dGTP

Also found in: Dictionary, Acronyms, Wikipedia.

dGTP

(dē′jē′tē′pē′)
n.
One of the two purine nucleotides that are used to synthesize DNA.
The American Heritage® Medical Dictionary Copyright © 2007, 2004 by Houghton Mifflin Company. Published by Houghton Mifflin Company. All rights reserved.
Mentioned in
References in periodicals archive
DGTP is to act as a link connecting all hoteliers in the emirate - providing learning opportunities and facilitating the implementation of initiatives.
The first nucleotide dispensed, dATP, is not incorporated into either nascent strand, whereas the next one, dGTP, is incorporated twice on the strand for the wild-type allele and only once on the strand for the mutant allele, causing the polymerase molecules to go out of phase.
As described previously [28], 20 [micro]L reaction mixtures contained 10 mM tris-HCl; pH 8.0; 50 mM KCl; a 200 [micro]M concentration of (each) ATP, dGTP, and dCTP; 400 [micro]M dUTP; 0.05 [micro]M of TaqMan probe 52-TM (CGTGCAGGGTCCGGGGTC); 0.3 pmol each of primers 52JA-3 (GAACACAGTGTAGCTAACGCACG) and 52JA-4 (GCATGACGTTACACTTGGGTCA) (targeting the E6 gene); 2.0 mM Mg[Cl.sub.2]; and 5 units of AmpliTaq gold DNA polymerase.
For PCR amplification of the CYP3A43 rs501275 polymorphism we used the primers F 5'-GTCAATGGCAATTTTCTGTT-3' and R 5'-CTGTCTTCACAAACCAGATG-3' in a 50 [micro]l reaction mix containing 50 ng of genomic DNA, 120 ng of each of the forward (F) and reverse (R) primers, 200 [micro]M of dATP, dCTP, dGTP and dTTP, 1.5 mM Mg[Cl.sup.2], 1 [micro]l 10 x Taq DNA polymerase buffer, and 0.5 U Taq DNA polymerase.
Standard Polymerase Chain Reaction (PCR) was carried out in 25[micro]l final volume containing 50 ng/[micro]l of genomic DNA; 1X Ammonium buffer; 1.25 mM of Mg[Cl.sub.2]; 12.5 pmol of each primer pair; 0.04 mM of each deoxynucleotide (dTTP, dGTP, dCTP, and dATP); 0.5 U of Taq Recombinant polymerase (Fermentas Life Sciences, USA).
ABBREVIATIONS: bDNA = Branched DNA; DNA = Deoxyribonucleic Acid; dNTP = Deoxyribonucleotides; dATP = Deoxyadenosine Triphosphate; dCTP = Deoxycytidine Triphosphate; dGTP = Deoxyguanosine Triphosphate; dTTP = Deoxythymidine Triphosphate; FDA = Food and Drug Administration; FRET = Fluorescence Resonance Energy Transfer; MRSA = Methicillin Resistant Staph aureus; MTB = Mycobacterium tuberculosis; NASBA = Nucleic Acid Sequence Based Amplification; PCR = Polymerase Chain Reaction; PFGE = Pulsed-Field Gel Electrophoresis; RT-PCR = Reverse Transcription Polymerase Chain Reaction; Taq = Thermus aquaticus; TMA = Transcription-Mediated Amplification; VRE = Vancomycin Resistant Enterococcus.
Omission of dATP, dTTP, or dGTP during the telomerase extension step of the TRAP reaction resulted in no elongation products being amplified; however, omission of dCTP did not affect the formation of a ladder pattern of telomerase products (data not shown).
A reaction mixture of 25 ml containing 10 mM Tris-HCl (pH 8.3 at 25[degrees]C), 50 mM KCl, 3 mM Mg[Cl.sub.2], 0.1 mM each of dATP, dGTP, dTTP and dCTP, one unit of Taq DNA polymerase (Perkin Elmer, Norwalk, Conn.), 0.001% gelatin (Sigma, St-Louis, Mo.), 25 ng of template DNA and 30 ng of primer was prepared and overlaid with two drops of mineral oil in order to avoid evaporation.
El segmento de la region promotora del gen de la IL-10 entre las posiciones -1120 y -533, se amplifico por la reaccion en cadena de la polimerasa (PCR), realizada en el termociclador (iCicler, Bio Rad), en un volumen de reaccion de 50 [micron]l, asi: 250 ng de ADN, 20 mM Tri HCl, pH 8,0, 100 mM de KCl (Corpogen, Colombia), 2 mM Mg[Cl.sub.2], 200 [micron]M de cada dGTP, dATP, dTTP, dCTP (Promega, Madison, WI), O,5 [micron]M de cada iniciador (5'-ATCCAAGACAACACTA CTAA-3' y 5'-AAATATCCTCA AAGTTCC-3') y 2,5 unidades de Taq polimerasa (Corpogen, Colombia).
The reaction volume was adjusted to 50 [micro]l using PCR buffer to reach the final concentrations of 10 mM Tris-HCl (pH 9.0), 50 mM KC1, 0.1% Triton X-100, 2.5 mM Mg[Cl.sub.2], dNTPs (dATP, dGTP, dCTP, dTTP, 200 [micro]M each), and 5% DMSO.
The final reaction mixture was of 25 [micro]L, containing 1[micro]L of template, 1 [micro]L of each primer, water for PCR and a mixture for PCR 2x that includes Taq polymerases for DNA, 0.05 U/[micro]l; the deoxynucleotide triphosphates at 0.4 mM (dATP, dCTP, dGTp and dTTP) and Mg[Cl.sub.2] 4mM (Fermentas [R]).
Copyright © 2003-2025 Farlex, Inc Disclaimer
All content on this website, including dictionary, thesaurus, literature, geography, and other reference data is for informational purposes only. This information should not be considered complete, up to date, and is not intended to be used in place of a visit, consultation, or advice of a legal, medical, or any other professional.