EREG

A gene on chromosome 4q13.3 that encodes epiregulin, a member of the epidermal growth family, which is a ligand of the EGF receptor (EGFR) and ERBB4 and may mediate localised cell proliferation. It may also stimulate cell proliferation and/or angiogenesis.

Mentioned in

epiregulin

References in periodicals archive

As sequencias dos primers para Ereg (iniciador sense: ACTGCACAGCATTAGTTCAAACTGA; iniciador anti-sense: TGTCCATGCAAACAGTAGCCATT) e ciclofilina (SANTOS et al., 2011) foram obtidas utilizando Primer Express Software v3.0 (Applied Biosystems, USA) e sintetizados pela Invitrogen.

Angiotensin-(1-7) during the initial process of ovulatory cascade in cattle/Angiotensina-(1-7) durante o processo inicial na cascata da ovulacao em bovinos

At PND49, fat pad length and ductal elongation were also unchanged by HFD and maternal TCDD exposure, and at PND50, we found no treatment-associated changes in expression of mammary morphology regulators Egf and Ereg (data not shown).

Maternal dioxin exposure combined with a diet high in fat increases mammary cancer incidence in mice

Instead, we used the more conservative generalized linear model (Proc GLM; SAS Institute Inc.) to evaluate the effect of TCDD, DMBA, and diet on phenotypes (body weight, percent body fat, fasting blood glucose, branch elongation, fat pad length, number of terminal end buds, size of terminal end buds, and fold change) (Livak and Schmittgen 2001) of Cyp1a1, Cyp1a2, Cyp1b1, Areg, Ereg, Egf, Rac1, Tgfb, Bax, Ccnd1, Mki67, Igf1, Fgf2, Ahr, Egfr, and Esr1 levels.

Dietary fat alters body composition, mammary development, and cytochrome P450 induction after maternal TCDD exposure in DBA/2J mice with low-responsive aryl hydrocarbon receptors

All content on this website, including dictionary, thesaurus, literature, geography, and other reference data is for informational purposes only. This information should not be considered complete, up to date, and is not intended to be used in place of a visit, consultation, or advice of a legal, medical, or any other professional.