genetically modified organism

(redirected from Transgenic animals)
Also found in: Dictionary.

genetically modified organism

n. Abbr. GMO
An organism whose genetic characteristics have been altered by the insertion of a modified gene or a gene from another organism using the techniques of genetic engineering.
Mentioned in ?
References in periodicals archive ?
It facilitates the development of transgenic animal models, and may lead to therapeutic benefits for people as well.
The idea must arise from reading about the Harvard Mouse case and transgenic animals.
GTC develops, produces, and commercializes therapeutic proteins through transgenic animal technology.
With transgenic animals developed for human consumption, there is a possibility (although the probability is low) that a few new proteins expressed when genes are inserted from another species may trigger allergic or hypersensitive reactions in a small, but unknown, percentage of people.
Even on a cellular level, the distinction between species and animal/vegetable are blurring: transgenic animals are being engineered by fusing human genes with the genes of domestic animals, and the genes of a tomato can be spliced with those of a fish.
holds the patent on the DNA microinjection technique used by a number of groups producing transgenic animals.
Antibodies from transgenic animals have proven to be the most productive platform for human antibody drug discovery and development.
We used transgenic animals carrying a reporter construct that consists of three estrogen-responsive elements (GAGCTTAGGTCACTGTGACCT) upstream of a minimal human E1B TATA promoter sequence (GGGTATATAAT) coupled to luciferase surrounded by chicken [beta]-globin insulator (Chung et al.
Yale University (New Haven, CT) has patented genetic constructs and methods for the production, maintenance and control of transgenes in transgenic eukaryotic organisms that undergo meiosis in which pollen or sperm can be outcrossed; this includes: transgenic animals, plant cells, plant tissues and whole plants.
PPL Therapeutics intends eventually to create transgenic animals that produce therapeutic proteins in their milk.
With this transaction, OMT formally launches "OmniAb[TM]", a new integrated antibody discovery suite with superior protein and DNA immunization, OMT's proprietary OmniRat[TM] transgenic animals, and the GEM deep antibody screening technology.
Recombinant host cells, recombinant nucleic acids, recombinant proteins and transgenic animals are also disclosed, along with methods of producing each.