ELK4

(redirected from Sap1)
Also found in: Acronyms.

ELK4

A gene on chromosome 1q32 that encodes a member of the ETS family of transcription factors and ternary complex factor (TCF) subfamily, which form a complex by binding to the serum response factor and serum reponse element in the c-fos proto-oncogene promoter. ELK4 is activated by MAPK1 and MAPK8 signal-induced phosphorylation.
References in periodicals archive ?
Gene Primer sequence (5' [right arrow] 3') Forward primer ACT1 TTTAAGAATTGATTTGGCT HWP1 ATGACTCCAGCTGGTTC SAP1 TCAATCAATTTACTC1TCCATTTTAACA PLB2 GTGGGATCTrGCAGAGTTCAAGC Gene Primer sequence (5' [right arrow] 3') Annealing temp ([degrees]C) Reverse primer ACT1 GAAGATTGAGAAGAAGTTT 48 HWP1 TAGATCAAGAATGCAGC 59 SAP1 CCA GTA GCA TTA ACA GGA GTT TTA ACA 60 PLB2 CTCAAAGCTCTCCCATAGACATCTG 54 Table 2 Yeast to hyphal transition in Candida albicans in the presence of OSEO.
Figure 3 also showed the SWA of SAP1 was higher than that of SAP3 under most of pH conditions, which could be attributed to the higher affinity of RO-P[O.
Because the network of SAP1 contained the functional group of RCO[O.
It was found that under different pH conditions, the order of SR for three types of SAPs was SAP2 > SAP1 > SAP3.
From these figures, we could observe that (1) the order of SR of SAP was SAP2 > SAP1 > SAP3, which was relative to the capability of acquiring and carrying water of functional groups bonded to SAPs networks; (2) WA showed the maximum for bivalent cations in the swelling process, and the swelling process obviously displayed the exclusive volume effect.
WA of SAP2 changed sharper in divalent cations solutions than that of SAP1 and SAP3.