restriction site

(redirected from Restriction sites)
Also found in: Dictionary, Thesaurus, Encyclopedia, Wikipedia.
Related to Restriction sites: Restriction digest

re·stric·tion site

a site in nucleic acid in which the bordering bases are of such a type as to leave them vulnerable to the cleaving action of an endonuclease.
Synonym(s): cleavage site

re·stric·tion site

(rĕ-strik'shŭn sīt)
A site in nucleic acid in which the bordering bases are of such a type as to leave them vulnerable to the cleaving action of an endonuclease.
Synonym(s): cleavage site.

restriction site

the specific nucleotide site recognized by restriction endonuclease. Called also restriction endonuclease site.

restriction site bank

Patient discussion about restriction site

Q. Is anyone restricted to have barley? what is the benefit of having barley and what is the best way to consume them? Is anyone restricted to have barley?

A. It grows in many parts of the world. As it is a whole grain it is good for health. It has soluble fiber and reduces blood cholesterol and glucose. It is low in fat content. No fixed way is there to eat barley as it’s used as soup thickener; it’s used in baked foods. Many breakfast foods include barley as baked breads. It is found to harm none.

Q. Is exercise recommended during pregnancy, if yes, are there any restrictions during pregnancy? I am in my 13 weeks of pregnancy. I always try to keep me fit and I do cycling every morning, swimming and yoga. These days I feel my body is changing and I am feeling more tiresome and nauseated. Is exercise recommended during pregnancy, if yes, are there any restrictions during pregnancy?

A. I exercised all through my pregnancies. I only gained a total of 10-12 pounds each time. I had easy deliveries because of the exercise. This has nothing to do with nausea. I had 9 months of nausea the first time around. Don't overdo the exercise, walking is the best exercise ever, and I climbed hills and stairs and walked several miles a day. My shortest delivery time was 5 minutes. I almost did not make it to the hospital. All my babies were healthy.

Q. What actions should i take in order to keep my self in a sharp and restricted fitness control?

A. I would try some body weight circuits 3 to 4 times a week.

More discussions about restriction site
References in periodicals archive ?
Approx 30% of the genotyped animals presented additional restriction sites resulting in a new fragment.
1) was produced using oligonucleotide primers p903SalI (5'GTCGACATAAG TAGGAAATTAAAGTCCAGTAAGGTTACTGGCATTTCT [This oligonucleotide primer was appended with a SalI restriction site (underlined) and the introduced late gene polyhedrin core promoter sequence, ATAAG (bold)]), and p738 (5'ACGAGCT GTGAACT CACCAAGAAT CCAACGTT) with cDNA being generated using oligonucleotide primer p738.
PCR mutagenesis was performed to introduce an AatII restriction site into the second codon of the HC-Pro gene.
Rapid and cost-effective polymorphism identification and genotyping using restriction site associated DNA (RAD) markers.
Numbers in parenthesis indicate the number of species within each family containing the correct restriction site.
For [lambda] DNA sequences, we counted the number of reads mapped to each restriction site and ignored sites with restriction fragment lengths of <30 bp (because 25 bp was used for alignment).
In a previous study, data for species-specific mtDNA restriction site variation in the ND3/ND4 region were presented for 15 Sebastes species (Gharrett et al.
The search function was used to identify restriction site mutations and select appropriate restriction enzymes for CAPS marker development.
1992) analyzed mtDNA restriction sites and allozymes of mule deer and white-tailed deer from western Texas and found an mtDNA genotype that was shared by 67% of the white-tailed deer and 100% of the mule deer.
A phylogenetic analysis of the grass family (Poaceae) was conducted using two character sets, one representing variation in 364 mapped and cladistically informative restriction sites from all regions of the chloroplast genome, the other representing variation in 42 informative "structural characters.
Certainly, a molecular systematist or ecologist needs to know how to sequence DNA (or at least understand the basics of sequence evolution), but I think she also needs to know how to map restriction sites and interpret ailozyme patterns.