Powassan virus


Also found in: Dictionary, Thesaurus, Legal, Encyclopedia, Wikipedia.
Related to Powassan virus: Ixodes cookei

Pow·as·san vi·rus

a virus of the genus Flavivirus (family Flaviviridae), transmitted by ixodid ticks and causing Powassan encephalitis in children; also capable of producing meningoencephalomyelitis in rabbits and children.
[Powassan, Ontario, the Canadian province where first isolated]

Powassan virus

A rare Flavivirus, transmitted by tick bite, which occasionally causes encephalitis.
See also: virus

Powassan,

city in Ontario, Canada, where disease was first reported.
Powassan encephalitis - an acute disease of children, transmitted by ixodid ticks.
Powassan virus - causes Powassan encephalitis.

Powassan virus

References in periodicals archive ?
An increase in reported cases of Powassan virus occurred in 2016, with two states reporting their first cases.
Prevalence and genetic characterization of Powassan virus strains infecting Ixodes scapularis in Connecticut.
The principal vector of Powassan virus is Ixodes cookei, the woodchuck tick.
Seroprevalence of Powassan virus in New England deer, 1979-2010.
Louis encephalitis virus (10), Powassan virus (8), Eastern equine encephalitis virus (8), and unspecified California serogroup virus (5).
Powassan virus infection presenting as acute disseminated encephalomyelitis in Tennessee.
For example, Powassan virus spreads to humans from animal reservoirs by the same tick genus (Ixodes) that transmits Lyme disease and babesiosis.
Provisional cases of infrequently reported notifiable diseases (< 1,000 cases reported during the preceding year)--United States, week ending October 18, 2014 (42nd week) (Export data) Disease Current Cum 5-year week 2014 weekly average ([dagger]) Anthrax -- -- -- Arboviral diseases ([section]), ([paragraph]): California -- 49 1 serogroup virus disease Eastern equine -- 7 0 encephalitis virus disease Powassan virus -- 7 0 disease St.
After WNV, the next most commonly reported cause of arboviral disease was La Crosse virus (LACV) (85 cases), followed by Jamestown Canyon virus (JCV) (22), Powassan virus (POWV) (15), and eastern equine encephalitis virus (EEEV) (eight).
Powassan virus is a positive-sense RNA virus that belongs to the tick-borne encephalitis group of flaviviruses (1).
Powassan virus (POWV) is a tick-borne virus (family Flaviviridae, genus Flavivirus) with recent and increasing prevalence.
Primers for MassTag central nervous system infections panel, RNA pathogens Target Primer sequence, Pathogen gene 5' [right arrow] 3' * Eastern equine E1 Fwd: ACACTAAATTCACCCTAGTTCGAT encephalitis virus Rev: GTGTATAAAATTACTTAGGAGCAGCATTATG Nipah/Hendra virus Phos Fwd: GGGGGAATGYCTAAGRATGATG Rev: TCCGGTACATTCTCCTCCATG Japanese NS5 Fwd: TCAACCTAGGGAGCGGAACA encephalitis virus Rev: GGCTGAGCCAGTAGCCTTCA Parechovirus 5UTR Fwd: ACACTAGTTGTAAGGCCCACGAA Rev: GGTBTGGCCCACTAGACGTTTT Powassan virus NS5 Fwd: CATCCGACCATGCACCTAGA Rev: CCAAAGTGAGGATGTGTACCAAAG La Crosse virus S Fwd: CTCAACCTTGCTGCAGTTAGGA Rev: CCACCTGCCACTCTCCAAA Lymphocytic pol Fwd: CCACTYTTGTCTGCACTGTCTAT choriomeningitis Rev: CTTTTTGATGCGCAATGGAT virus St.