PPIA


Also found in: Acronyms, Encyclopedia.

PPIA

A gene on chromosome 7p13 that encodes peptidylprolyl cis-trans isomerase A (cyclophilin A), which, as with other PPIs, accelerates protein folding. It catalyses the cis-trans isomerisation of proline-imidic peptide bonds in oligopeptides. It also interacts with HIV-1 capsid protein.
References in periodicals archive ?
1 IGF1 F: TCTCAACATCTCACATCTCT 136 R: AAGCAGCACTTAACTAATTGT NM_001199909 PDK4 F: TGCAATCACCAAAGGTCACCA 87 R: TGCAGTAGCTGAAGCTGTGTT NM_204728 PPARD F: TCTCCAAGCACATCTACAA 75 R: CGGTCAAGATACCTCTCG NM_00166326 PPIA F: GGCTCCCAGTTCTTCATC 143 R: ATCTGCTTGCTCGTCTTG NM_205103 TBP F: TGAATAGCACACGCACTA 178 R: GAGGCAACACATACTGAAC GenBank [T.
The expertise and knowledge of several faculty members from AUB departments, new staff members and the diversity of students it brings together are considered to be points of strength for PPIA.
The diversity of the courses, the access to PPIA professors who are both excellent practitioners and academics, and the location of the program at AUB, in the heart of the Arab region, form key factors contributing to the successful design of a program bringing Public Policy and International Affairs together," Farea al-Muslimi, an AUB graduate from Yemen and newly admitted student, said.
Online applications for the PPIA graduate program are opened, and students are encouraged to apply for the spring and summer semesters," AUB said.
8] Human genes: PPIA, peptidylprolyl isomerase A (cyclophilin A); PPP3R1, protein phosphatase 3, regulatory subunit B, a; PPP3CA, protein phosphatase 3, catalytic subunit, a isozyme; PPP3CB, protein phosphatase 3, catalytic subunit, isozyme; FKBP1A, FK506 binding protein 1A, 12 kDa; CALM1, calmodulin 1 (phosphorylase kinase, 8); IL2, interleukin-2; IL2RA, interleukin 2 receptor, a; JUN, jun proto-oncogene; NFATC1, nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 1.
Based on the geNorm programs, the most stable reference genes in both whole blood and PBMC were PPIA and B2M.
Therefore, we recommend using the geometric mean of the first three stable genes, TBP, PPIA, and B2M, to normalize the gene expression of whole blood and PBMC with poly I:C stimulation.
1]; RPLP0, ribosomal protein, large, P0 [NM_001002]; PPIA, peptidylprolyl isomerase A (cyclophilin A) [NM_021130]; GSTP1, glutathione S-transferase pi 1 [NT_167190.
For that purpose, we measured miR-155, miR-200c, and CDH16, PPIA, and TBP expression in samples of nonmalignant renal tissue after radical nephrectomy and measured miR-130b, miR205, and HIF1A, KLK3, and HPRT1 expression in nonmalignant samples of prostate tissue after radical prostatectomy (Fig.
6] Human genes: CDH16, cadherin 16, KSP-cadherin; HIF1A, hypoxia-inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor); HPRT1, hypoxanthine phosphoribosyltransferase 1; PPIA, peptidylprolyl isomerase A (cyclophilin A); KLK3, kallikrein-related peptidase 3; TBP, TATA box binding protein; RN18S1, RNA, 18S ribosomal 1; MIR155HG, MIR155 host gene (nonprotein coding).
4]Human genes: FASLG, Fas ligand (INF superfamily, member 6); PPIA, peptidylprolyl isomerase A (cyclophBin A); BCL2, B-cell CLL/lymphoma 2