PPIA


Also found in: Acronyms, Encyclopedia.

PPIA

A gene on chromosome 7p13 that encodes peptidylprolyl cis-trans isomerase A (cyclophilin A), which, as with other PPIs, accelerates protein folding. It catalyses the cis-trans isomerisation of proline-imidic peptide bonds in oligopeptides. It also interacts with HIV-1 capsid protein.
References in periodicals archive ?
Nevertheless, the Vermont District Court also held that these preemption successes could not support a preliminary injunction, in large part because, given its exemption of meat, the Vermont GE food labeling statute was unlikely to apply to the food products that the FMIA and PPIA actually govern.
However, transcript abundance of reference genes, including ACTB, GAPDH, HPRT, and PPIA genes significantly changed when RNA was isolated from the muscle stored on ice for 1.
PPIA program is perceived as the "academic side" of the Issam Fares Institute for Public Policy and International Affairs.
8] Human genes: PPIA, peptidylprolyl isomerase A (cyclophilin A); PPP3R1, protein phosphatase 3, regulatory subunit B, a; PPP3CA, protein phosphatase 3, catalytic subunit, a isozyme; PPP3CB, protein phosphatase 3, catalytic subunit, isozyme; FKBP1A, FK506 binding protein 1A, 12 kDa; CALM1, calmodulin 1 (phosphorylase kinase, 8); IL2, interleukin-2; IL2RA, interleukin 2 receptor, a; JUN, jun proto-oncogene; NFATC1, nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 1.
Especially, TBP was ranked as the most stable reference gene in both whole blood and PBMC, while B2M and PPIA were the second and third most stable ones.
Furthermore, the Cq values for the 2 RGs showed very little variation in the context of the 11 different triplex reactions: The mean (SD) Cq values obtained for PPIA and B2Mwere 19.
PPIA and SRIA together provide nearly 500 regular flights per week or 58 flights per day (22 flights to Phnom Penh, and 36 flights to Siem Reap), connecting Cambodia to 26 destinations in Asia and Europe.
The PPIA supported talented and committed students of color through a series of activities culminating in a Master's degree in public policy or international affairs.
Primer sequences for real-time RT PCR analysis Molecule Forward primer sequence Reverse primer sequence (5' [right arrow] 3') (5' [right arrow] 3') GAPDH GTCCACTGGTGTCTTCACGA GTCATGAGTCCCTCCACGAT HPRT GGCAAAACAATGCAAACCTT GGGACTCCAGATGTTTCCAA PPIA AGCACTGGGGAGAAAGGATT GCCATCCAACCACTCAGTCT 2-F-06 AACCCAAACACTCCAAAACG CAGTTCGGTCGTCTGGATTT 3-B-04 AAGCAGGTGGACGTGTAACC AAGCAGGTGAGTTGGCTAGG 4-H-05 CGGACAGAGGTTGGAGAGAG GGTGTCAGGTGCTTCAGGAT 5-B-11 CACGCCTCTCTGGACAAGTT GCCCACTCAGGCTTTATTCA 5-G-07 CCAAATGCACAGATGTCCTG CACCTCCGAGATGACCTGTT 6-B-06 CGAGGAGCACTGCACTAGGT CTTCCTAGGACCAGCCCTTC 8-E-11 CAAGCCGTGGAGTAGGTTGT TGCTCGGCCCTAGTTTACTC PPIA = Cyclophilin A, GAPDH = Glyceraldehyde-3-phsphate dehydrogenase, HPRT = Hypoxanthine phosphoribosyltransferase.
The FSA would be responsible for administering the existing major food safety laws including the FFDCA, FMIA and PPIA.
Details on the measurement of mRNAs encoded by CDH16 [6] (cadherin 16, KSP-cadherin), HIF1A [hypoxiainducible factor 1, a subunit (basic helix-loop-helix transcription factor)], HPRT1 (hypoxanthine phosphoribosyltransferase 1), PPIA [peptidylprolyl isomerase A (cyclophilin A)], KLK3 (kallikrein-related peptidase 3; also known as PSA), and TBP (TATA box binding protein) are provided in Supplemental Text 1, Table 2, A and B, and Fig.