P. ovale

P. ovale

abbreviation for Plasmodium ovale.
References in periodicals archive ?
knowlesi was detected by using a set of primers specific for the 18S rRNA gene (13), and differentiation of 2 subspecies of P.
Sympatric distribution of Plasmodium ovale curtisi and P.
malariae F ATAACATAGTTGTACGTTAAGA ATAACCGC 144 R AAAATTCCCATGCATAAAAAAT TATACAAA 144 P.
On the basis of differences in its gene sequences, P.
Relatively high parasitemia levels were found in some patients with P.
malariae, PM18SF: 5'-GAGACATTC ATATATATGAGTG-3' and PM18SRc: 5'-GGGA AAAGAACGTTTTTATTAAAAAAAAC-3'; P.
Further, captive chimpanzees and bonobos have been shown to have malaria parasites related to human P.
pdf) demonstrates that these apes are most likely naturally infected with P.
Failure of PCR amplification has been reported for some P.
More recently, however, with the aid of polymerase chain reaction (PCR)-based species identification and improved microscopic techniques, P.
More recently, two types of sequences have been characterized for the ookinete surface protein genes, Pos 25, Pos 28-1, and Pos 28-2 in P.
4 cases per 100,000 inhabitants, respectively, (139 and 171 cases in total); P.