NADH dehydrogenase


Also found in: Wikipedia.

NADH de·hy·dro·gen·ase

an iron-sulfur-containing flavoprotein reversibly oxidizing NADH to NAD+; an inherited deficiency of this complex results in overwhelming acidosis.

NADH de·hy·dro·gen·ase

(dē-hī'drŏ-jen-ās)
An iron-sulfur-containing flavoprotein reversibly oxidizing NADH to NAD+; an inherited deficiency of this complex results in overwhelming acidosis.
References in periodicals archive ?
In our study, DNA sequences of the mitochondrial protein-coding NADH dehydrogenase subunit 5 gene (ND5) were acquired to assess the genetic diversity and female effective population size ([N.
Briefly, primers were used to amplify a 470 base pair region of the NADH dehydrogenase subunit 1 (NAD1) mitochondrial gene (Bowles and McManus 1993).
The plastid ndh genes encode components of the thylakoid Ndh complex, which is analogous to the NADH dehydrogenase or complex I of the mitochondrial respiratory chain and catalyzes the transfer of electrons from NADH to plastoquinone [32,6,28].
JX415820); NADH dehydrogenase subunit 1 (primers: NAD1-FF 5'-ATTGGKT TATTTCAGAGTTTTTCTGATT TA-3' and NAD1-RR 5'-CTCMC CATAATCAAATGGACTACG-3', 394 bp, GenBank accession no.
On the other hand, oxidative phosphorylation functions; the activity of NADH dehydrogenase and succinate dehydrogenase in respiratory chain of liver mitochondria were normalized in rats with alloxan diabetes after oral administration of ecdysterone (Tashmukhamedova et al.
by a mutation of a transcriptional inhibitor) could cause an increased amount of the subunit and thus increased activity of NADH dehydrogenase (Complex I) in the mitochondria.
In the bovine heart mitochondrial preparations the authors demonstrated that a Dox dose of 25-50 [mu] moles represents the oxidative damage and as they cited this appears to be localized between the NADH dehydrogenase flavin and iron-sulphur center N-1, SDH and cytochrome (oxidase activities) where these two enzymatic activities were shown by Dox by the above authors.
Coenzyme Q10 is a naturally occurring hydrophobic substance that is involved in electron transfer across the mitochondrial membrane from the NADH dehydrogenase complex and the succinate-Q reductase complex to cytochrome c (Cephalalgia 2002;22:137-41).
For example, Complex I is also called NADH dehydrogenase as well as coenzyme Q reductase.
1 (MBNL3), transcript variant 1 NADH dehydrogenase (ubiquinone) 1 XM_001234600.
PCR was performed by using primers for 4 mitochondrial loci: NADH dehydrogenase subunit 1 (nad1) and 2 (nad2), cytochrome b (cob), and cytochrome c oxidase subunit 1 (cox1) (3,4).
3B) NADH dehydrogenase (NDUFV2), peroxiredoxin 6 (PRDX6), and Cypl7[alpha] were also significantly down-regulated.