Mycoplasma hominis


Also found in: Dictionary, Thesaurus, Wikipedia.

Mycoplasma

 [mi´ko-plaz″mah]
a genus of highly pleomorphic, gram-negative, aerobic or facultatively anaerobic bacteria that lack cell walls, including the pleuropneumonia-like organisms and other species.
Mycoplasma ho´minis a species found associated with nongonococcal urethritis and mild pharyngitis.
Mycoplasma pneumo´niae a cause of primary atypical pneumonia; called also Eaton agent.

My·co·plas·ma hom·i·nis

a bacterial species that is the causative agent of pelvic inflammatory disease and other genitourinary tract infections; can also cause chorioamnionitis and postpartum fever; can be an oropharyngeal commensal and has caused nosocomial wound infections.

My·co·plas·ma hom·i·nis

(mī'kō-plaz'mă hom'i-nis)
A bacterial species that is an agent of pelvic inflammatory disease and other genitourinary tract infections; can also cause chorioamnionitis and postpartum fever.

Mycoplasma hominis

A species of Mycoplasma that can cause genital tract infections (nongonococcal urethritis).
See also: Mycoplasma
References in periodicals archive ?
Culture for Mycoplasma hominis and Ureaplama urealyticum: From plain PPLO broth used for transport of urethral swabs, 1 ml of the broth was passed into PPLO broth made selective for M.
Occurrence of Ureaplasma urealyticus and Mycoplasma hominis in non-gonococcal urethritis before and after treatment in a double-blind trial of ofloxacin versus erythromycin.
Reduced susceptibility to tetracyclines is associated in vitro with the presence of 16S rRNA mutations in Mycoplasma hominis and Mycoplasma pneumoniae.
Mycoplasma hominis endocarditis in a child with a complex congenital heart defect.
SOD d1 5' CCITAYICITAYGAYGCIYTIGARCC Enterobacteriaceae RpoB CM7 5' AACCAGTTCCGCGTTGGCCTGG Mycoplasma hominis FtsY MH1F 5' GTGTTGTATCGACAACAG Coxiella burnetii IS111 Trans3 5' CAACTGTGTGGAATTGATGA Bartonella spp.
Aerobic and anaerobic cultures remained sterile as did cultures for Ureaplasma urealyticum and Mycoplasma hominis on special media (Biomerieux, Nurtingen, Germany).
Azithromycin for injection is indicated for the treatment of patients with infections caused by susceptible strains of the designated microorganisms in the following conditions: community-acquired pneumonia due to Chlamydia pneumoniae, Haemophilus influenzae, Legionella pneumophila, Moraxella catarrhalis, Mycoplasma pneumoniae, Staphylococcus aureus, or Streptococcus pneumoniae in patients who require initial intravenous therapy and pelvic inflammatory disease due to Chlamydia trachomatis, Neisseria gonorrhoeae, or Mycoplasma hominis in patients who require initial intravenous therapy.
Evaluation of intraspecies genetic variation within the 16S rRNA gene of Mycoplasma hominis and detection by polymerase chain reaction.
Azithromycin for Injection is indicated for the treatment in patients who require intravenous therapy for infections caused by susceptible strains of the designated microorganisms in: 1) Community-acquired pneumonia due to Chlamydia pneumoniae, Haemophilus influenzae, Legionella pneumophila, Moraxella catarrhalis, Mycoplasma pneumoniae, Staphylococcus aureus, or Streptococcus pneumoniae; and 2) Pelvic inflammatory disease due to Chlamydia trachomatis, Neisseria gonorrhoeae, or Mycoplasma hominis.

Full browser ?