ALG1

(redirected from MT-1)

ALG1

A gene on chromosome 16p13.3 that encodes an enzyme that catalyses the first mannosylation step in the biosynthesis of lipid-linked oligosaccharides.

Molecular pathology
ALG1 is mutated in congenital disorder of glycosylation type Ik (CDGIk).
References in periodicals archive ?
RESULTS: There was a positive correlation between blood MT-1 and MT-2 transcripts and corresponding hepatic or renal MT transcript levels in rats and mice.
The MT-1 and MT-2 isoforms are most widely expressed, whereas MT-3 is largely brain-specific and MT-4 is located mainly in stratified squamous epithelia (Cherian et al.
a) Forward [beta]-actin (human) X00351 ACTGGAACGGTGAAGGTGACA MT-1A (human) NM_005946 CTCGAAATGGACCCCAACTG MT-2A (human) NM_005953 GTGCCCAAGGCTGCATCT MT-3 (human) NM_005954 AGTGCGAGGGATGCAAATG MT-4 (human) U07807 TCCAGGCCTCATGTGATTCAC [beta]-actin (rat) V01217 TCCTCCTGAGCGCAAGTACTCT MT-1 (rat) NM_138826 TGTGCCTGAAGTGACGAACAG MT-2 (rat) M11794 GGGAACTGGGCAGGAATAACA [beta]-actin (mouse) M12481 GGCCAACCGTGAAAAGATGA MT-1 (mouse) BC027262 AATGTGCCCAGGGCTGTGT MT-2 (mouse) NM_008630 TGTGCCTCCGATGGATCCT Gene symbol Accession no.
The correlation analysis between blood MT-1 and MT-2 transcript and corresponding liver or kidney transcript in rats is shown in Figure 1.
There was a strong correlation between individual hepatic MT protein level and hepatic MT-1 transcript (Figure 2A; p [& lt] 0.
It was also shown that the MT-1 and MT-2 isoforms had a low level of expression in normal urothelium and were overexpressed in many bladder cancers, with overexpression correlating to tumor grade (8).
The immunoblot protocol used for the determination of the levels of MT-1 and MT-2 and MT-3 protein in cell lysates has been described previously (26,27).
Immunoblotting with an MT antibody that recognizes both the MT-1 and MT-2 isoforms, but not the MT-3 or MT-4 isoforms, demonstrated that the cells expressed 0.
That the MT-2 anti-sense sequence was productive in inhibiting MT-1 and MT-2 isoform-specific mRNA expression was confirmed by the finding that no MT-1/2 protein was detected in any of the four clones.