MMP7

(redirected from MMP-7)

MMP7

A gene on chromosome 11q21-q22 that encodes matrix metalloproteinase 7, which degrades proteoglycans, fibronectin, elastin and casein and activates procollagenase. It is involved in breaking down the extracellular matrix in physiological processes—e.g., embryonic development, reproduction, tissue remodelling and wound healing. It differs from most MMP family members as it lacks a conserved C-terminal protein domain.
 
Molecular pathology
Defects in MMP7 have been linked to arthritis and metastasis.
References in periodicals archive ?
Additionally, the study found that PTE suppresses the invasiveness of pancreatic cancer cells, which was associated with the reduction of MMP-7.
Further studies are now in progress to investigate the exact mechanism of the inhibition of MMP-7 expression and further evaluation of the anticancer and anti-metastatic activity of PTE.
It achieved this by reducing the expression of MMP-1, MMP-2, and MMP-7, by blocking MAPK signaling by inhibiting the phosphorylation of ERIC and p38 MAPK, by inhibition of AP-1 activation, and by inducing focal adhesion formation and modulating vinculin localization and expression.
Gene Forward Reverse Amplicon size MMP-1 GGTCTCTGAGGGTCAAGCAG AGTTCATGAGCTGCAACACG 207bp MMP-2 AGCTCCCGGAAAAGATTGAT TCCAGAATTTGTCTCCAGCA 225bp MMP-7 GTGGTCACCTACAGGATCGTA CTGAAGTTTCTATTTCTTTCTTGA 492bp TIMP-1 GGGGCTTCACCAAGAGCCTGAG AAGAAAGATGGGAGTGGGAACA 280bp TIMP-2 CCACCCAGAAGAAGAGCCTGAG TGGACCCATGGGATGAGTGTTT 370bp [beta]-Actin GGACTTCGAGCAAGAGATGG AGCACTGTGTTGGCGTACAG 243bp Primers were used in RT-PCR experiments (35 cycles) in which the annealing temperature was set to 60 [degrees] C to assess gene expression in HepG2 cells.
MMP-7 is a member of the MMP gene family, which is currently composed of 23 members in humans.
For immunohistochemistry, the sections were reacted with monoclonal antibodies specific to proMMP-7 (141-7B2; 4 [micro]g/mL; Daiichi Fine Chemical Co, Ltd), active MMP-7 (176-5F12; 10 [micro]g/mL; AbD Serotec Morphosys UK, Ltd, Oxford, United Kingdom), or CD151 (11G5a; 5 [micro]g/mL; Daiichi Fine Chemical Co, Ltd) for approximately 18 hours at 4[degrees]C after blocking endogenous peroxidase and nonspecific binding according to our methods.
MMP-1, MMP-2, MMP-3, MMP-7, MMP-8, MMP-9, MMP12, and MMP-13 were simultaneously measured using the Fluorokine MultiAnalyte Profiling assays (R&D Systems) on a Luminex 100 Bioanalyzer (Luminex.
samples; (c) MMP-2, MMP-3, and MMP-7 measured in citrate-plasma were roughly comparable to the 2 serum-type samples and heparinplasma, with differences of only 15% for MMP-2 and about 25% for MMP-3 and MMP-7; (d)MMP measurement results in EDTA-plasma samples were more highly variable than those obtained in citrateor heparin-plasma samples.
MMP-7 is secreted as a precursor (pro-MMP-7) that is activated by 4-aminophenylmercuric acetate and trypsin in a stepwise manner (17).
There has been no published report of increased MMP-7 or pro-MMP-7 levels in renal cancer patient serum.
Similar to MMP-9, MMP-7 is produced in vulnerable regions of the atherosclerotic plaque; however, MMP-7 has a distribution that is distinct from that of MMP-9 in the lesions and also differs in substrate specificity (18).
The MMP and TIMP-1 concentrations in plasma were measured with the Biotrak MMP-2, MMP-3, and TIMP-1 human ELISA systems (Amersham Biosciences) and the Quantikine human MMP-7 ELISA (R & D Systems Europe Ltd.