Also found in: Acronyms.


Acronym for myoclonic epilepsy with ragged red fiber myopathy. One of the mitochondrial disorders, this condition is caused by a point mutation of the mitochondria genome locus 8344, where transfer RNA is coded.


Myoclonus Epilepsy with Ragged Red Fibers Neurology A mitochondrial myopathy characterized by myoclonus, epilepsy and ataxia, maternal inheritance. See Ragged red fibers. Cf MELAS.


Acronym for myoclonic epilepsy with ragged red fiber myopathy. One of the mitochondrial disorders, this condition is caused by a point mutation of the mitochondria genome locus 8344, where transfer RNA is coded.
References in periodicals archive ?
Advances in molecular neuroscience can help render focused, reliable diagnoses for some mtDNA disorders in which specific causative mutations are known, such as LHON, MELAS, MERRF, and KearnsSayre syndrome.
High prevalence of the COII/tRNA (Lys) intergenic 9-bp deletion in mitochondrial DNA of Taiwanese patients with MELAS or MERRF syndrome.
org 1,2,3,4,5,6,7 MERRF SYNDROME See: Myoclonus; Mitochondrial Disorders METABOLIC DISORDERS See also: Acidemia, Organic; Galactosemia; Lactic Acidosis; Maple Syrup Urine Disease; Niemann-Pick Disease; Phenylketonuria (PKU) Metabolic Information Network PO Box 670847 Dallas, TX 75367-0847 (800) 945-2188 (USA/Canada) (214) 696-2188 (800) 955-3258 (fax, USA/Canada) (214) 696-3258 (fax) ?
MERRF, MELAS, Kearns-Sayre), Krebs acid cycle defects, gluconeogenesis defects (e.
net 1,2,3,4,5,6,7; regional conferences MERRF SYNDROME See: Myoclonus; Mitochondrial Disorders METABOLIC DISORDERS See also: Acidemia, Organic; Galactosemia; Lactic Acidosis; Maple Syrup Urine Disease; Niemann-Pick Disease; Phenylketonuria (PKU) Association for Neurometabolic Disorders 5223 Brookfield Ln.
b) MELAS, mitochondrial encephalomyopathy, lactic acidosis, and stroke-like episodes; homo, homoplasmy; hetero, heteroplasmy; LHON, leber hereditary optic neuropathy; MERRF, myoclonic epilepsy and ragged red fibers; NARP, neuropathy, ataxia, and retinitis pigmentosa; mult.
To rule out the most common point mutations in mtDNA, several point mutations causing MEZAS, MERRF, NARP, Leigh, and (or) LHON syndromes may need to be evaluated.
mtDNA mutations that account for adult forms of myopathy, cardiomyopathy, MERRF, multisystem disorders, and mutations associated with aging such as Alzheimer and Parkinson diseases are apparently underrepresented.
The A3243G mutation accounts for 80% of patients with MELAS (mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes) [2], and the A8344G mutation accounts for 80% of patients with MERRF (myoclonic epilepsy and ragged-red fibers) [3, 4].
The forward primer used for MERRF was 5'CTACCCCCTCTAGAGCCCAC3'.