ITPR1

ITPR1

A gene on chromosome 3p26.1 that encodes an intracellular receptor for a so-called second messenger (inositol 1,4,5-trisphosphate (IP3)) which, once stimulated by IP3, mediates calcium release from the endoplasmic reticulum. The three IP3 receptor subtypes—IP3R1, IP3R2 and IP3R3—are present in the wild as homo- and heterotetramers, are associated with calmodulin and FK506-binding protein, and are modulated through phosphorylation by PKA, PKC, PKG and CaMKII.

Molecular pathology
IPTR1 mutations cause spinocerebellar ataxia type 15.
References in periodicals archive ?
573); while the other genes associated with these pathways are down-regulated (ATM, CAMK4, FNBPI, ITPR1, NAPEPLD, PIK3R1, PRKA, PRKCH, and RHOH).
This genome-wide ChIP-on-chip analysis of target genes of RORA, as well as additional methods of validation, confirmed that RORA transcriptionally regulates the genes A2BP1, CYP19A1, HSD17B10, ITPR1, NLGN1, and NTRK2, such that when RORA levels are cut in half, all six genes also go down in their expression.
The relative expression of CDK1, CDK2, CCNB1, GTSE1, ITPR1, c-MYC, SRGAP3, HIST2H3D, HIST] H3J, TOP2A, CCNA2 and RHOJ was determined.
3 26 SYBR_CAPDH_rev TTGATTTTGGAGGGATCTCG 20 CCNA2, cyclin A2; CCNB1, cyclin B1; CDK1, cyclin-dependent kinase 1; CDK2, cyclin-dependent kinase 2; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; GTSE1, G-2 and S-phase expressed 1; HIST, histone cluster; ITPR1, inositol 1,4,5-triphosphate receptor, type 1; MYC, myelocytomatosis viral oncogene homolog; RHOJ, ras homolog gene family, member J; SRGAP3, SLIT-ROBO Rho GIPase activating protein 3; TOP2A, topoisomerase (DNA) Il alpha 170 kDa.
ITPR1, c-MYCand SRGAP3, which are all involved in the PDGF signalling pathway, were also upregulated using qRT-PCR.
3]R isoforms, IDCs and MDCs express message for ITPR1 and ITPR3, the latter down-regulated with maturation (Table 1).