IGFBP2

IGFBP2

A gene on chromosome 2q33-q34 that encodes a member of the insulin-like growth factor binding protein (IGFBP) family that binds insulin-like growth I and II and circulates in the plasma. IGFBP2 binding prolongs the half-life of the IGFs, alters their interaction with cell surface receptors, and inhibits IGF-mediated growth and development.
References in periodicals archive ?
Grey, Shorthorn (2011) and Hereford, Brahman, Santa Gertrudis and Belmont Red 2 Angus, Murray IGFBP2 Bolorma et al.
Expression profiling of synovial sarcoma by cDNA microarrays: association of ERBB2, IGFBP2, and ELF3 with epithelial differentiation.
077236 dominant negative helix-loop-helix protein IGFBP2 Insulin-like growth factor -1.
The researchers found that the hormone controls the activity of a gene known as IGFBP2 in the liver, which has antidiabetic effects in animals and could have similar therapeutic effect in humans.
Treatments designed to increase IGFBP2 expression in obese and diabetic mice reversed their diabetes.
They also found that leptin-deficient patients do indeed have lower blood levels of IGFBP2 at baseline and that those levels can be raised with low-dose leptin treatment.
En vacas (8), la reduccion de la LH por la progesterona exogena fue asociada a un aumento en la IGFBP2 (secretada por las celulas de la granulosa del ovario bovino).
39) The methylation status of the IGFBP2 locus (insulin growth factor-binding protein) and GDF10 locus (bone morphogenetic protein) is significantly higher in MPM for Japanese patients than US patients.
49 GGACACCGAAGTGGACATGA (F) CACCAGACCGTTCTTCTCCC (R) IGFBP2 0.
In this regard, it is interesting to mention that IGFBP2 was significantly overexpressed by 2-fold in liver of both groups of exposed rats.
84) In another study in which a quantitative proteomics approach was used, IGFBP2, kallikrein 1 precursor, and several other proteins were identified from pancreatic juice, a finding that can potentially differentiate chronic pancreatitis and pancreatic cancer.