HSPD1

(redirected from GroEL)
Also found in: Wikipedia.

HSPD1

A gene on chromosome 2q33.1 that encodes a mitochondrial protein of the chaperonin family, which may function as a signalling molecule in the innate immune system. It is essential for the folding and assembly of newly imported proteins in mitochondria. HSPD1 is adjacent to a related gene; the region between the two acts as a bidirectional promoter.

Molecular pathology
HSPD1 mutations cause autosomal recessive spastic paraplegia 13.
References in periodicals archive ?
Multilocus sequence typing data of 8 genetic loci of 4 Bartonella henselae isolates from 2 naturally infected cats * Isolate 16S rRNA batR gltA ftsZ groEL nlpD ribC FR96/BK36 1 2 1 2 2 1 1 FR96/BK36II 2 1 1 1 2 1 1 FR96/BK75 2 1 1 1 2 1 1 FR96/BK75II 2 4 2 3 1 2 2 Isolate rpoB ST FR96/BK36 1 14 FR96/BK36II 1 5 FR96/BK75 1 5 FR96/BK75II 1 7 * Values are allele numbers.
chaffeensis in sika deer (Cervus nippon) in Japan, we examined blood specimens by using PCR amplification of the 16S rRNA and groEL genes.
For the isolate from the red fox from France, extracted DNA was also amplified for fragments of the groEL gene by using the primer sets HSPps1, HSPps2, and HSPsp4 (11,14).
Unfortunately, none of the 82 specimens were positive when PCR primers targeting the groEL gene were used.
More taxonomic studies should sequence other housekeeping genes, such as rpoB, 16S rRNA, ftsZ, groEL, and ribC, to confirm whether these isolates are novel Bartonella spp.
Nucleotide sequences of real-time PCR products demonstrated 100% identity with 17-kDa antigen, groEL, and ompB genes of R.
ewingii, and the EML pathogen by using a modified version of a multiplex PCR assay targeting a conserved region of the groEL heat-shock protein operon (13) (online Technical Appendix Table 1, http://wwwnc.
groEL and msp4 genes showed a 1,650-bp sequence (FJ477840, corresponding to 748 of 1,650 bp) and an 852-bp sequence (FJ460443) for these genes, respectively.
FlaLL flaB ACATATTCAGATGCAGACAGAGGT FlaRL flaB GCAATCATAGCCATTGCAGATTGT FlaLS flaB AACAGCTGAAGAGCTTGGAATG FlaRS flaB CTTTGATCACTTATCATTCTAATAGC BL-Fla 522F flaB GGTACATATTCAGATGCAGACAGAGGG BL-Fla 1182R flaB GCACTTGATTTGCTTGTGCAATCATAGCC BL-Fla 662F flaB CTGAAGAGCTTGGAATGCAACCTGC BL-Fla 860R flaB GAGCTAATCCCACCTTGAGCTGG BL-Fla 341F flaB AGCTGATGATGCTGCTGGTATGGG BL-Fla 730R flaB GCTTGTGCTCCAGTTAGTGATGCTGG BL-16S 227F 16S TCACACTGGAACTGAGATACGGTCC BL-16S 920R 16S GAATTAAACCACATGCTCCACCGC BL-HSP 71F groEL CTTATGTTGAAGGAATGCAATTTGA BL-HSP 271R groEL CAATATCTTCAGCAATAATTAGCAAAGGT Rickettsia spp.
mikurensis, we sequenced 1,426 bp of the 16S rRNA and 1,233 bp of the groEL gene (1).
Selecting the Hifn 9620 compression processor was a natural choice for us because it is the fastest solution available on the market for LZS and is optimized for back-up applications," said Peter Groel, President, MPTapes.
miyamotoi sensu lato, including the flagellin FlaB protein, the GroEL heat shock proteins, and the BmpA (P39) protein (19,25).