SLC2A12

(redirected from GLUT12)

SLC2A12

A gene on chromosome 6q23.2 that encodes a membrane-bound facilitative glucose transporter.
References in periodicals archive ?
1), GTCAACACAGTCTTCACCTTAGTCT (forward), CCAGGCCCAGGAGATGGA (reverse); GLUT8 (AY 208940), TTCAGCAGTCTCATGGAGGT (forward), TTTGGA GTCACAGGTAGGCT (reverse); GLUT12 (NM 001011683.
Tsakiridis, "Expression of the glucose transporters GLUT1, GLUT3, GLUT4 and GLUT12 in human cancer cells," BMC Proceedings, vol.