GJA1


Also found in: Dictionary, Thesaurus, Legal, Acronyms, Encyclopedia, Wikipedia.
Related to GJA1: Cx43

GJA1

A gene on chromosome 6q21-q23.2 that encodes an alpha chain of the gap junction protein family, or connexins.

Molecular pathology
GJA1 mutations are associated with oculodentodigital dysplasia and cardiac malformations.
References in periodicals archive ?
15] Equally, in the GJA1, five variants were detected; one of these occurred in the intron, but none were known to be pathogenic.
Few mutations in GJB2, GJB6 or GJA1 genes among other populations of African ancestry
a) Gene Forward primer Reverse primer CDH1 AACGCATTGCCACATACACTCT CATTCTGATCGGTTACCGTGATC E2F1 GAGCAGATGGTTATGGTGATCAAA AGGGCACAGGAAAACATCGA GAPDH GGAGTCCCTGCCACACTCA GCCCCTCCCCTCTTCAAG GJA1 CCAAAGACTGTGGGTCTCAA CTCACTTGCTTGCTTGTTGTA HBEGF AGGACTTCTGCATCCATGGA TGGTCATAGGTATATAAGCGAT IGFBP5 CTCACTTGCTTGCTTGTTGTA GCACTGCTTTCTCTTGTAGAA IL1R2 TGTGCTGGCCCCACTTTC GCACAGTCAGACCATCTGCTTT IL8 GTGCAGTTTTGCCAAGGA TTCTGTGTTGGCGCAGTG KRT13 GCGGGACTACAGCCCCTACTAC CCAGCCTGGCATTGTCAAT MMP2 GCACTGCTTTCTCTTGTAGAA GATCTGAGCGATGCCATCAA PRSS11 CCGTGGTTCATATCGAATTGT CCGTGGTTCATATCGAATTGT S100A8 TGGAGAAAGCCTTGAACTCTATCA GGTCTCTAGCAATTTCTTCAGGTCAT THBD GAGGACGTGGATGACTGCATACT GGTACTCGCAGTTGGCTCTGA VAV3 GAACAAGGGACACTCAAACTACCA GTTCCTAATGACCTGCATCTTTGG (a) Primer sequences were designed by Primer Express 2.