genotypic antiretroviral resistance testing

(redirected from GART)
Also found in: Dictionary, Acronyms, Encyclopedia, Wikipedia.

genotypic antiretroviral resistance testing

,

GART

Analysis of HIV samples to see if they will respond to treatment with antiretroviral drugs.
References in periodicals archive ?
In mismatch repair-proficient control blood samples, isSIR values for GART, AC1, TGFBRII, MSH3, and MSH6 microsatellite primer extension products representing one or two nucleotide deletions (-1/wt; -2/wt) were in the range of 0.
These included 4 alterations in GART (-1 and +1 frameshifts), 4 alterations in AC1 (-1 frameshift), 11 alterations in TGFBRII (-1, -2, and +1 frameshifts), 5 alterations in MSH3 (-1 and -2 frameshifts), and 7 alterations in MSH6 (+1 and +2 frameshifts).
Repeat Type Sequence (5'-3') GART X54199 A10 Sense AGTGTTGAAGAATGGCTCCCT Antisense TGTTCCCAGATATTAAGACAGCCAC AC1 D82070 T10 Sense TCACAAGACTCACAATTCAAAGAA Antisense TTTTGCGTGTTCCTTCCTTC TGFBRII D50683 A10 Sense CATGACCCCAAGCTCCCCTAC Antisense CATGAAGAAAGTCTCACCAGG MSH3 J04810 A8 Sense AAATGTGAATCCCCTAATCAAGC Antisense ACTTACCACAATGCCAATAAAAAT MSH6 U54777 C8 Sense GGGTGATGGTCCTATGTGTC Antisense CGTAATGCAAGGATGGCGTG PCR primers Gene Type Extension primer (5'-3') GART Sense [AGCCACTCTGGCC(T).