References in periodicals archive ?
AY599661 94 Aa2 Tenacibaculum maritimum AB078057 93 Ae1 Tenacibaculum maritimum AB078057 93 Band Phylum number St1 Firmicutes Sa1 Firmicutes Sa2 Firmicutes Sa3 Firmicutes Se1 Firmicutes Se2 Firmicutes Se3 Firmicutes Ps1 [alpha]-Proteobacteria Pt1 Firmicutes Pa1 Bacteroidetes Pa2 Bacteroidetes Pa3 Firmicutes Pe1 Firmicutes Cs1 Firmicutes Cs2 Bacteroidetes Ct1 Firmicutes Ca1 Firmicutes Ce1 Firmicutes Ce2 Firmicutes Ce3 Bacteroidetes Ce4 Bacteroidetes As1 [gamma]-Proteobacteria As2 [gamma]-Proteobacteria As3 Bacteroidetes As4 ND At1 Bacteroidetes At2 Bacteroidetes Aa1 Bacteroidetes Aa2 Bacteroidetes Ae1 Bacteroidetes ND=Not determened
During the maturation stage, sequences obtained from samples C5 and C6 were grouped to several phyla, that is, phyla Bacteroidetes, Proteobacteria, and Firmicutes following a decrease in compost temperature.
The 16s rRNA gene copies of phylum Firmicutes and Bacteroidetes in rumen Item Corn grain proportion (% of DM) 0 25 50 Firmicutes (x [10.
Primer sequences and PCR reaction conditions Assay Primer name Primer sequence (5' to 3') Total bacteria U968GC CGCCCGGGGCGCGCCCCGGGCGGGGCGGG GGCACGGGGGGAACGCGAAGAACCTTAC L1401 CGGTGTGTACAAGACCC Total bacteria Bact1369F CGGTGAATACGTTCYCGG Bact1492R GGWTACCTTGTTACGACTT Bacteroidetes Bact934F GGARCATGTGGTTTAATTCGATGAT Bact1060R AGCTGACGACAACCATGCAG Firmicutes Firm934F GGAGYATGTGGTTTAATTCGAAGCA Firm1060R AGCTGACGACAACCATGCAC Methanogens Methanogen-F TTCGGTGGATCDCARAGRGC Methanogen-R GBARGTCGWAWCCGTAGAATCC Sulfate-reducing DsrA-F CCAACATGCACGGYTCCA bacteria DsrA-R CGTCGAACTTGAACTTGAACTTGTAGG Assay Annealing temp.
He said that people who ate a healthy diet, containing high levels of complex carbohydrate, had significant populations of micro-organisms in their gut called Firmicutes.
Effect of dietary Bacillus subtilis on proportion of Bacteroidetes and Firmicutes in swine intestine and lipid metabolism.
It should have read, "The proportion of Bacteroidetes in their guts rose, while the proportion of Firmicutes dropped.
Members of the following phyla were detected in nearly all of the samples: Actinobacteria, Bacteroidetes, Chloroflexi, Cyanobacteria, Firmicutes, and Proteobacteria (Alphaproteobacteria, Betaproteobacteria, Deltaproteobacteria, and Gammaproteobacteria).
On the other hand, the Firmicutes bacteria made up less than 70 percent and just more than 50 percent of the gut flora in indoor and isolated bred pigs respectively.
Those bacterial types are called Firmicutes and Bacteroidetes.
By phyla (major divisions of bacterial type), he found healthy adults to have 51% Firmicutes and 41% Bacteroidetes, whereas he found 40% Firmicutes and 57% Bateroidetes in the elderly.
Firmicutes species are lower in CVD patients, and CHD plaque also has higher ratio of Pseudomaoadaceae to Firmicutes bacteria and DNA.