Fibrobacter succinogenes


Also found in: Wikipedia.

Fibrobacter succinogenes

one of the predominant anaerobic gram negative bacteria species in ruminal contents.
References in periodicals archive ?
These include Fibrobacter succinogenes (intestinalis), Ruminococcus albus, Ruminococcus flavefaciens, Butyrivibrio species, Prevotella ruminicola, and Clostridium herbivorans (Varel and Yen, 1997).
While urea degrades/decomposes to ammonia and carbon dioxide through the action of urease the chicken manure acts as a microbial growth factor by providing the source of Fibrobacter succinogenes.
Ruminococcus albus, Ruminococcus flavefaciens, and Fibrobacter succinogenes are dominant cellulolytic bacteria existing in the rumen.
PCR primers: The PCR primer sets (Table 2) used in this study for amplification of total bacteria, Fibrobacter succinogenes, Ruminococcus albus, Ruminococcus flavefaciens, methanogenic archaea, and ciliate protozoa were from the published reports (Koike and Kobayashi, 2001; Denman and McSweeney, 2005; Skillman et al.
Factors affecting adhesion of Fibrobacter succinogenes S85 and adherence defective mutants to cellulose.
1987) also reported that treatment of Fibrobacter succinogenes, Ruminococcus flavefaciens, and Ruminococcus albus with 0.
Previous studies have revealed the detailed rumen metabolism of Fibrobacter succinogenes subsp.
PCR primers: The PCR primer sets used in this study for amplification of general bacteria, Fibrobacter succinogenes, archaea, methanogenic archaea, ciliate-associated methanogen and four different groups of methanogens (the order Methanobacteriales, the order Methanomicrobiales, the order Methanosarcinales and the order Methanococcales) were the same as referenced by Denman and McSweeney (2006), Tajima et al.
Most ruminal cellulolytic microorganisms, such as Ruminococcus albus, Ruminococcus flavefaciens, Fibrobacter succinogenes, and Butyrivibio fibrisolvents, require branched-chain volatile fatty acids (BCVFA, i.
2004) observed that application of EFE from Trichoderma promoted adhesion of Fibrobacter succinogenes S85 to and degradation of corn silage and alfalfa hay, but not pure cellulose.
PCR primers and reference strains used to amplify target rumen bacteria in this study Target bacteria Primers (5' [right arrow] 3') Fibrobacter F:GGTATGGGATGAGCTTGC succinogenes R:GCCTGCCCCTGAACTATC Succinivibrio F:CGTCAGCTCGTGTCGTGAGA dextrinosolvens R:CCCGCTGGCAACAAAGG Selenominas F: TGCTAATACCGAATGTTG ruminantium R:TCCTGCACTCAAGAAAGA Streptococcus F:CTAATACCGCATAACAGCAT bovis R:AGAAACTTCCTATC TCTAGG Megasphaera F:AGATGGGACAACAGCTGGA elsdenii R:CGAAAGCTCCGAAGAGCCT Prevotella F:GAAAGTCGGATTAATGCTCTATGTTG ruminicola R:CATCCTATAGCGGTAAACCTTTGG Target bacteria Reference strains Reference Fibrobacter Fibrobacter succinogenes Tajima et al.