FGF10


Also found in: Acronyms.

FGF10

A gene on chromosome 5p13-p12 that encodes fibroblast growth factor 10 of the FGF family, which bind heparin and have a broad range of cellular activities, including cell survival, division, differentiation and migration, embryonic development, morphogenesis, tissue repair, tumour growth and invasion. Its name notwithstanding, FGF10 is mitogenic for keratinocytes but has little effect on fibroblasts; FGF10 interacts with FGF receptors FGFR1 and -2.

Molecular pathology
Defects in FGF10 cause autosomal dominant aplasia of lacrimal and salivary glands and lacrimo-auriculo-dento-digital syndrome (LADDS).
References in periodicals archive ?
6] Human genes: FGF2, fibroblast growth factor 2 (basic); FGF1, fibroblast growth factor 1 (acidic); FGF7, fibroblast growth factor 7; FGFR1, fibroblast growth factor receptor1; FGF18, fibroblast growth factor 18; FGF23, fibroblast growth factor 23; FGF5, fibroblast growth factor 5; FGFR2, fibroblast growth factor receptor 2; FGFR4, fibroblast growth factor receptor 4; FGF14, fibroblast growth factor 14; FGF9, fibroblast growth factor 9; FGF10, fibroblast growth factor 10.
FGF10 is required for cell proliferation and gland formation in the stomach epithelium of the chicken embryo.
Primer pairs used to analyze gene expression by quantitative RT-PCR, and size of product Gene Forward primer (a) Reverse primer (a) THBS1 TTCAAGCGGAGTAACTGGCGTAG TGTGCAGTGGCACAAATAGCAA KIT CCCTTGCAGAGACCCACATTC TCTGTAGCATTGCCTTGAGTGGA FGF10 CTGTAGAAATTGGAGTTGTGGCAGT GCCTTCCATTGTGCTTCCAAT CCL1 AAACTGCTCCCGCAGAGCTATTA TTGGTGGCAGCTCACGTTG GAPDF GAGAAATTGTGCGTGACATCA CCTGAACCTCTCATTGCCA Gene Size (bp) THBS1 95 KIT 122 FGF10 180 CCL1 135 GAPDF 152 (a) Sequences of oligonucleotides are indicated from 5' to 3' end.
These growth factors can exert paracrine effects on uterine LE/sGE, GE and conceptus trophectoderm that express receptors for FGF7 and FGF10 (FGFR2IIIb) and HGF (MET; protooncogene MET); however, in ewes, FGF10 appears to be the primary progestamedin expressed by uterine SC (Chen et al.
P4 stimulates expression of both HGF and FGF10 by ovine uterine stromal cells.