MAPK3

(redirected from ERK1)
Also found in: Acronyms, Wikipedia.

MAPK3

A gene on chromosome 16p11.2 that encodes a protein of the MAP kinase family. MAP kinases (e.g., extracellular signal-regulated kinases) integrate multiple biochemical signals and are involved in cell proliferation, differentiation, transcription, regulation and development. Once MAPK3 is activated by phosphorylation by an upstream kinase, it translocates to the nucleus of the stimulated cell, where it phosphorylates target molecules.
References in periodicals archive ?
Primer sequences (5' to 3') ZO-1 ZO-1-f GACTTAAAGCTGCCTCAACA ZO-1-r GGTTTGTTTCAGGCGAAAGT Claudin-1 Claudin-1-f TTCTGGGAGGTGCCCTACTT Claudin-1-r TGGATAGGGCCTTGGTGTTG Occludin Occludin-f CCATGGCCTACTACTCGTCC Occludin-r CGGCACCGGTGTTGATTTAT ERK1 ERK1-f TGCATTCTGGCTGAGATGCT ERK1-r TGAGCTGGTCCAGGTAGTGC ERK2 ERK2-f CCGTGACCTCAAACCTTCCA ERK2-r CCAACCCAAAGTCACAGATC p90RSK p90RSK-f ACCTGGTGTCAAAGATGCTTC p90RSK-r CAGTGGACGATCCAAGGATGT TCGGAAGTGTGTATCCCGTAGG GCAAGGAACACGGCTAAGTTG Gene Annealing GenBank temperature accession no.
As observed with ERK1 /2 activation, the EGFR inhibitor AG1478 and the ERK inhibitor PD, but not the PICA inhibitor H89, repressed the up-regulation of these proteins by BPA (Figure 3C).
Conversely, immortalized mouse mammary fibroblasts from AhR-null mice had decreased migration capacities in culture and inhibition of signaling pathways that regulate cell migration, including focal adhesion kinase and mitogen-activated protein kinase ERK1 (extracellular-signal regulated kinase-1) (Mulero-Navarro et al.
Lapatinib binds to the ATP-binding pocket of and inhibits epidermal growth factor receptor (EGFR) and HER2 and inhibits self-phosphorylation and downstream ERK1 /2 and AKT which leads to growth arrest and/or apoptosis (Xia et al.
Briefly, ERK1 /2 (duplex) and phospho (Ser473)/total AKT plates were blocked (MSD blocking solution, as recommended by the manufacturer, plus 0.
Furthermore, they show that the effects of Nc-5-s may be mediated through the ERK1 /2 pathway and/or the Akt/phosphoinositide 3-kinase pathway and their downstream effectors.
As the effects of Nc-5-s on LPS-induced cytokine secretion by THP-1 monocytes may in part be mediated through activation of the ERK1 /2 kinase, we investigated whether a known MEK1 /2 inhibitor, U0126, affected LPS-induced cytokine secretion by THP-1 cells in the same way as Nc-5-s.