Chlamydiaceae


Also found in: Dictionary, Thesaurus, Encyclopedia, Wikipedia.
Related to Chlamydiaceae: Chlamydiales, Green sulfur bacteria, chlamydiae, Chlamydiæ

Chlamydiaceae

 [klah-mid″e-a´se-e]
a family of bacteria containing a single genus, Chlamydia.

Chla·myd·i·a·ce·ae

(kla-mid'ē-ā'sē-ē),
A family of the order Chlamydiales (formerly included in the order Rickettsiales) that includes the agents of the psittacosis-lymphogranuloma-trachoma group. The family contains small, coccoid, gram-negative bacteria that resemble rickettsiae but that differ from them significantly by possessing a unique, obligately intracellular developmental cycle; intracytoplasmic microcolonies give rise to infectious forms by division. The classification of these organisms previously was in a state of flux, but they are now placed in a single genus, Chlamydia, the type genus of the family.

Chlamydiaceae

/Chla·myd·i·a·ceae/ (klah-mid″e-a´se-e) a family of bacteria (order Chlamydiales) consisting of small coccoid microorganisms that have a unique, obligately intracellular developmental cycle and are incapable of synthesizing ATP. They induce their own phagocytosis by host cells, in which they then form intracytoplasmic colonies. They are parasites of birds and mammals (including humans). The family contains a single genus, Chlamydia.

Chla·myd·i·a·ce·ae

(klă-mid'ē-ā'shē-ē)
A family of the order Chlamydiales (formerly included in the order Rickettsiales) that includes the agents of the psittacosis-lymphogranuloma-trachoma group. The family contains small, coccoid, gram-negative bacteria that resemble rickettsiae but differ from them by possessing a unique, obligately intracellular developmental cycle. Intracytoplasmic microcolonies give rise to infectious forms by division.

Chlamydiaceae

a family of obligately intracellular gram-negative bacterial pathogens that parasitize the host cell for ATP. Outside the host cell they exist as elementary bodies, which are 200-300 nm in diameter, have a rigid cell wall and adhere to host cells and are phagocytosed. Inside the host cell phagosome, they form larger reticulate bodies, which replicate, then form elementary bodies, which are released by cell lysis. Cultivable in cell cultures and the yolk sacs of chick embryos. Contains two genera, Chlamydia and Chlamydophila.
References in periodicals archive ?
Outcome variables included single or mixed infection, Chlamydiaceae species causing the infection, and ompA genotype.
In addition, the use of 2 independent methods to detect Chlamydiaceae, one of which used RNA to demonstrate the presence of viable Chlamydiaceae species in trachomatous eyes, lends further support to this theory.
Our study identified ocular infections with 5 Chlamydiaceae species among trachoma patients.
each containing one monotypic genus, revised taxonomy of the family Chlamydiaceae, including a new genus and five new species, and standards for the identification of organisms.
Initial evidence came from observations of recombination within ompA (4,31) followed by phylogenetic analyses (32), and bioinformatic and statistical analyses for multiple species of the family Chlamydiaceae and C.
Genome sequence of Chlamydophila caviae (Chlamydia psittaci GPIC): examining the role of niche-specific genes in the evolution of the Chlamydiaceae.
Primer pairs used for PCR of chlamydiaceae species and strains Sequence (5' Length of Primer [right sequence, Locus Region name arrow] 3') bp glyA CT432 FglyA GAAGACTGTGGCGCTGTTTTATGG 522 RglyA CTTCCTGAGCGATCCCTTCTGAC mdhC CT376 FmdhC GGAGATGTTTTTGGCCTTGATTGT 519 RmdhC CGATTACTGCACTACCACGACTCT pdhA CT245 FpdhA CTACAGAAGCCCGAGTTTTT 549 RpdhA CTGTTTGTTGCATGTGGTGATAAG yhbG CT653 FyhbG TCAAGTCAATGCAGGAGAAAT 504 RyhbG GATAGTGTTGACGTACCATAGGAT pykF CT332 FpykF ATCTTATCGCTGCTTCGTT 525 RpykF CAGCAATAATAGGGAGATA lysS CT781 FlysS GAAGGAATCGATAGAACGCATAAT 576 RlysS ATACGCCGCATAACAGGGAAAAAC leuS CT209 FleuS TCCCTTGGTCGATCTCCTCAC 519 RleuS GGGCATCGCAAAAACGTAAATAGT Table 2.
5) and immunohistochemical testing, but negative for Chlamydiaceae.
Fetal lung and liver were positive by realtime PCR for Chlamydiaceae (mean Ct for both organs 36.
trachomatis and the hsp60 of other Chlamydiaceae (Cp.
abortus and the influence of copper on the expression of stress response proteins in Chlamydiaceae.
Evidence that the novel microorganism "Z" may belong to a new genus in the family Chlamydiaceae.