CYP11A1


Also found in: Wikipedia.

CYP11A1

A gene on chromosome 15q23-q24 that encodes a member of the cytochrome P450 superfamily of enzymes, which catalyse reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. CYP11A1 localises to the mitochondrial inner membrane and catalyses the conversion of cholesterol to pregnenolone, the first and rate-limiting step in the synthesis of the steroid hormones.
Mentioned in ?
References in periodicals archive ?
The expression of CYP11A1 and CYP17A1 was not influenced by dietary SIF treatments.
1 F: CCTTCAATCGCCACTTCG 220 R: TCCCCTCACACCCACATC CYP11A1 NM_214427.
Transfers electrons from adrenodoxin reductase to CYP11A1, which catalyzes cholesterol side-chain cleavage FDXR Electron transport flavoprotein for mitochondrial P450s.
Members of CCAAT box family are known to be associated with CYP11A1, CYP17 and 3[beta]HSD as well as genes related to their action such as GLUT4 and peroxisome proliferator activated receptor-gamma (PPAR-[gamma]).
Ovarian expression of ERa/p, 3[beta]HSD, 17PHSD1, CYP11A1 and StAR mRNA in neonatal piglets was not affected by maternal dietary protein restriction.
1 R: TTTACCACAGAGGCAGAAG CYP11A1 149 F: GGCTCCAGAGGCCATAAAGA X13768.
Since tetracosactide stimulates both CYP11A1 and CYP11B1 activity (22,24,32-35), this peptide would be expected to increase both corticosterone synthesis and irreversible Me[SO.
We used same antibodies utilized for Western blot analysis, but at different concentrations; 1:100 for CYP19, 1:1,000 for CYP11A1, 1:200 for HSD17B4, 1:500 for CBR1, 1:500 for CYP17A, 1:200 for AKRIB1, and 1:500 of HSD3B.
Also, western blot analysis revealed that CYP11A1 protein abundance was not significantly different among experimental groups (Figure 2B).
CYP: CYP1A1, CYP1A2, CYP2B7, CYP2C9, CYP2C18, CYP2C19, CYP2D6, CYP2E1, CYP2J2, CYP4A11, CYP4F2, CYP7A1, CYP7B1, CYP8B1, CYP11A1, CYP17A1, CYP19A1, CYP24A1, CYP26A1, CYP26B1, CYP27B1, CYP39A1.