CDKN2A


Also found in: Dictionary.

CDKN2A

A gene on chromosome 9p21 that encodes an alternate open reading frame (ARF) product, which acts as a tumour suppressor by binding to MDM2 and blocking its nucleocytoplasmic shuttling by sequestering it in the nucleolus. This inhibits MDM2’s oncogenic activity, which would normally degrade p53, a tumour suppressor protein. CDKN2A also induces G2 arrest and apoptosis, independent of p53, by preventing the activation of cyclin B1/CDC2 complexes.

CDKN2A also binds to:
• BCL6, downregulating BCL6-induced transcriptional repression;
• E2F1 and MYC, blocking their transcriptional activator activity;
• HUWE1, repressing its ubiquitin ligase activity;
• TOP1/TOPOI, stimulating its activity. This complex binds to rRNA gene promoters and may play a role in rRNA transcription and/or maturation.

CDKN2A interacts with:
• COMMD1 and promotes its “Lys63”-linked polyubiquitination;
• NPM1/B23, promoting its polyubiquitination and degradation and inhibiting rRNA processing;
• UBE2I/UBC9, enhacing sumoylation of some of its binding partners (e.g., MDM2 and E2F1).
References in periodicals archive ?
Mutations in the tumor suppressor gene CDKN2A usually occur after KRAS mutations, and therefore are more prevalent in high-grade than in low-grade PanIN lesions.
3 which contained CDKN2A and CDKN2B genes, and they found that deletion of 6q21 ( PRDM1 ) was associated with shorter OS.
Analysis showed that a 10 per cent decrease in methylation at the CDKN2A gene was associated with an increase in fat mass of around 220g, at age four years.
TABLA I INCIADORES UTILIZADOS EN LA PRUEBA DE PCR PRIMER SECUENCIA Pares de Ta Reconocida Sentido/Antisentido bases CDKN2B GCGTTCGTATTTTGCGGTT 147 60[grados]C CGTACAATAACCGAACGACCGA CDH1 GCGTTTGGTCGCGGGAGTTC 142 53[grados]CC TTCCCTCAAAAATCGTCCCCAC APC TATTGCGGAGTGCGGGTC 108 63[grados]CC TCGACGAACTCCCGACGA CDKN2A TTATTAGAGGGTGGGGCGGATCGC 149 66[grados]CC GACCCCGAACCGCGACCGTAA hMLH1 AGAGTGGATAGTGATTTTTAATGT 130 60[grados]CC ACTCTATAAATTACTAAATCTCTTCA TABLA II ESTADO DE METILACION POR GENES ESTUDIADO Y POR ESTADIO CLINICO Genes Analizados Estadio II Estadio III Estadio IV % TOTAL P15 2(6,66%) 6(20%) 4(13,33%) 23,07% P16 1(3,38%) 2(6,6%) 5(16,66%) 15,39% hMLh1 0 0 4(13,33%) 7,7% CDH1 0 4(13,33%) 7(23,33%) 21,15% APC 2(6,6%) 7(23,33%) 8(26,66%) 32,69%
Researcher Dr Alexa Kimball, dermatology professor at Massachusetts, said CDKN2A activity is a sign that a cell is "tired out" and urged women to protect their skin all-year round and not just when on a beach holiday.
A clinician seeking to identify a trial containing a CDK4/6 inhibitor for a patient with an alteration in CDKN2A, which is also known as P16, INK4, INK4A, ARF, and P16INK4A, would obtain variable results based on the gene name used in the search at ClinicalTrials.
The effects of UV radiation are well known, and several mutations, such as CDKN2A and BRAF mutations, have been shown to correlate with malignant melanoma.
3) dysplastic nevus syndrome (or familial atypical multiple mole and melanoma syndrome, FAMMM-PC) due to mutations in the CDKN2A tumor suppressor gene.
Por otra parte, los segundos se caracterizan por la mutacion del gen TP53 y la baja regulacion de CDKN2A, que codifica para la proteina P16 (22,34).
INK4a] is a cyclin-dependent kinase inhibitor that inhibits cyclin dependent kinase 4 and 6, a product of the CDKN2A (INK4a) gene, involved in the phosphorylation of the retinoblastoma protein (Rb).
For example, we know a faulty CDKN2A and CDK4 gene indicates that you're at greater risk for melanoma.