CCR4


Also found in: Acronyms.

CCR4

A gene on chromosome 3p24 that encodes a G protein-coupled receptor for C-C-type chemokines (MIP-1, RANTES, TARC and MCP-1). CCR4 is a high-affinity receptor for the C-C-type chemokines CCL17/TARC and CCL22/MDC; its activity is mediated by Gi proteins, which activate phosphatidylinositol-calcium second messengers.
References in periodicals archive ?
Unlike antibodies to CCR4, FLX475 selectively blocks the recruitment of regulatory T cells to the tumor site, and does not deplete cells beneficial to an anti-tumor response or regulatory T cells in healthy tissue such as blood, spleen and skin cells.
Gene Locus Primer sequences Product size (bp) CCR1 Exon2 (61-481) Forward: GACTATGACACGACCACAGA 225 Reverse: GTAGATGGAGGACTTGGACCGGTAA CCR2 Exon1 (1-434) Forward: ACAGGAGCAGATGTACAG 253 Reverse: GTGATCATCCTCTCGTCTCT CCR3 Exon1 (238-780) Forward: CAGGAGGCTCCGAATTATGA 180 Reverse: ACTATGGTCTCGTGACTACC CCR4 Exon2 (118-660) Forward: CCACGGATATAGCAGACACC 450 Reverse: GAACTCCTCGGACATCTCAA CCR5 Exon2 (58-346) Forward: GGCTGAAGAGCATGACTGAC 403 Reverse: GATGGACGAGTTGGACCGGT Table 2--Concentration of purified UL128 protein.
The distribution of CC, CT and TT genotypes at position C1014T of CCR4 gene was 76 (51.
The control variables CCR4, REG and LITRISK are included for reasons discussed previously.
1 para los humanos es el CD161, el cual define una poblacion iNKT CD161+ capaz de diferenciarse en celulas productoras de IL-17, ademas de expresar CCR6 y CCR4 como tambien el receptor para IL23.
In previous studies, chemokine receptors, such as CXCR2 and CCR4, were genetically modified to be expressed on T cells to enhance their homing and antitumor activity [54, 55].
AT008 is directed against CCR4, an important G-protein coupled receptor (GPCR) on the surface of many cancer cells and cells of the immune system.
Differences in chemokine expression (CXCR3 [chemokine (C-XC motif) receptor 3] in 85% of LyPs and 8% of C-ALCLs and CCR4 [C-C chemokine receptor, type 4] in 92% of CALCLs and 15% of LyPs) may also be potentially useful in distinguishing C-ALCL and LyP but have not been evaluated in large numbers of cases.
Typically, CXCR3 and CCR5 are preferentially expressed on polarized Th1 cells, whereas CCR3, CCR4 and CCR8 have been associated with the Th2 phenotype.
As a ligand for CCR4 and CCR8, which are expressed by T cells, it might also be involved in the specific interaction of DCs with T cells.
51) In addition, interaction between CCR4 and its ligand TARC/CCL17 on activated endothelial cells mediates T cell extravasation by stimulating integrin-dependent adhesion of [CLA.