Also found in: Acronyms, Wikipedia.


A gene on chromosome 3p21.3 that encodes a G protein-coupled receptor for C-C-type chemokines, including eotaxin (CCL11), eotaxin-3 (CCL26), MCP-3 (CCL7), MCP-4 (CCL13) and RANTES (CCL5). It is highly expressed in eosinophils and basophils, as well as in TH1 cells, TH2 cells and airway epithelial cells; it may contribute to the accumulation and activation of eosinophils and other inflammatory cells in airways allergies, and is also an entry co-receptor for HIV-1.
References in periodicals archive ?
Gene Locus Primer sequences Product size (bp) CCR1 Exon2 (61-481) Forward: GACTATGACACGACCACAGA 225 Reverse: GTAGATGGAGGACTTGGACCGGTAA CCR2 Exon1 (1-434) Forward: ACAGGAGCAGATGTACAG 253 Reverse: GTGATCATCCTCTCGTCTCT CCR3 Exon1 (238-780) Forward: CAGGAGGCTCCGAATTATGA 180 Reverse: ACTATGGTCTCGTGACTACC CCR4 Exon2 (118-660) Forward: CCACGGATATAGCAGACACC 450 Reverse: GAACTCCTCGGACATCTCAA CCR5 Exon2 (58-346) Forward: GGCTGAAGAGCATGACTGAC 403 Reverse: GATGGACGAGTTGGACCGGT Table 2--Concentration of purified UL128 protein.
The eotaxin chemokines and CCR3 are fundamental regulators of allergen-induced pulmonary eosinophilia.
They detected the presence of the CCR3 protein in eye tissue from humans with AMD but not in that of individuals of similar age who did not have the disease.
Determination of CD69 and CCR3 surface expression were assessed using flow cytometry and FITC-labeled anti-CD69 and APC-labeled anti-CCR3 APC mAbs (ebioscience, Frankfurt, Getmany).
Functional expression of the eotaxin receptor CCR3 in CD30+ cutaneous T-cell lymphoma.
Typically, CXCR3 and CCR5 are preferentially expressed on polarized Th1 cells, whereas CCR3, CCR4 and CCR8 have been associated with the Th2 phenotype.
We also evaluated T cell- and NK cell-related genes, including CD3D [CD3d molecule, delta (CD3-TCR complex)], CD69 (CD69 molecule), PRF1 [perforin 1 (pore forming protein)], GNLY (granulysin), CCR3 [chemokine (C-C motif) receptor 3], KLRK1 (killer cell lectin-like receptor subfamily K, member 1), IDO1 (indoleamine 2,3-dioxygenase 1), and KLRD1 (CD94) (killer cell lectin-like receptor subfamily D, member 1).
Tat protein is an HIV-1 encoded beta-chemokine homolog that promotes migration and up-regulates CCR3 expression on human Fc epsilon R+ cells.
83) Debido a lo anterior, en estudios con modelos murinos se ha reportado que el antagonismo de su receptor, conocido como CCR3, inhibe la inflamacion en las fases temprana y tardia.
9), (10) The chemokine CCR3 is produced by Th2 lymphocytes and facilitates the migration of eosinophils, which are found in the lesional skin of patients with AD.
Antagonism of the chemokine receptor CCR3 as a potential therapeutic treatment for asthma
66) CCR3 is an eotaxin receptor that is also expressed on mast cells.