Also found in: Acronyms, Wikipedia.


A gene on chromosome 3p21.31 that encodes a receptor for monocyte chemoattractant protein-1 (MCP-1), a chemokine that mediates monocyte chemotaxis through agonist-dependent calcium mobilisation and inhibition of adenylyl cyclase. MCP-1 plays a role in monocyte infiltration in inflammatory responses to rheumatoid arthritis and tumours.
References in periodicals archive ?
Gene Locus Primer sequences Product size (bp) CCR1 Exon2 (61-481) Forward: GACTATGACACGACCACAGA 225 Reverse: GTAGATGGAGGACTTGGACCGGTAA CCR2 Exon1 (1-434) Forward: ACAGGAGCAGATGTACAG 253 Reverse: GTGATCATCCTCTCGTCTCT CCR3 Exon1 (238-780) Forward: CAGGAGGCTCCGAATTATGA 180 Reverse: ACTATGGTCTCGTGACTACC CCR4 Exon2 (118-660) Forward: CCACGGATATAGCAGACACC 450 Reverse: GAACTCCTCGGACATCTCAA CCR5 Exon2 (58-346) Forward: GGCTGAAGAGCATGACTGAC 403 Reverse: GATGGACGAGTTGGACCGGT Table 2--Concentration of purified UL128 protein.
The researchers found that a compound that inhibits the CCR2 protein could block the bone marrow's macrophages from entering the heart.
Polymorphism of CC chemokine receptors CCR2 and CCR5 in Crohn's disease.
Se trata de promover la aparicion de CCR2, por lo que el terapeuta debe ser capaz de actuar de forma que fomente este tipo de comportamiento por parte de la persona consultante.
To confirm the key role of CCR2 signaling in development of the observed movement-provoked pain behavior after surgery, the researchers administered a CCR2 receptor-blocker to normal mice at nine weeks after surgery and found that this reversed the decrease in distance traveled, that is, movement-provoked pain behavior.
The effects of acute exerciseinduced cortisol on CCR2 expression on human monocytes.
CCR2 is also critically important in recruitment of fibrocytes, myeloid lineage cells that produce collagen, and may also be important in fibrosis.
En la Figura 5, se pueden observar los cambios en el comportamiento del caso 1 tras introducir la intervencion derivada de la formulacion clinica, de tal forma que las CCR1 (problemas en consulta) disminuyeron su frecuencia de forma importante en dicha fase, mientras que las CCR2 (mejorias en consulta) tuvieron el efecto contrario incrementando su presentacion.
This study applied the constant return to scale DEA model which is called CCR2 (Charnes, Cooper, & Rhodes, 1978) to estimate the technical and pure-technical efficiency.
An antimicrobial peptide regulates tumor-associated macrophage trafficking via the chemokine receptor CCR2, a model for tumorigenesis.
Contrasting effects of CCR5 and CCR2 deficiency in the pulmonary inflammatory response to influenza A virus.
Hence, a study was conducted among IDUs of northeastern India to understand the existence and magnitude of genetic variants encoding CCR5, CCR2, and SDF1 and their relationships with the prevalence of HIV infection among them.