Also found in: Acronyms.


A gene on chromosome 3p21 that encodes a member of the beta chemokine receptor family, whose ligands include macrophage inflammatory protein 1 (MIP-1) alpha, regulated on activation normal T expressed and secreted protein (RANTES), monocyte chemoattractant protein 3 (MCP-3) and myeloid progenitor
inhibitory factor-1 (MPIF-1). The protein product transduces a signal by increasing intracellular calcium, and drives stem cell proliferation.
References in periodicals archive ?
Gene Locus Primer sequences Product size (bp) CCR1 Exon2 (61-481) Forward: GACTATGACACGACCACAGA 225 Reverse: GTAGATGGAGGACTTGGACCGGTAA CCR2 Exon1 (1-434) Forward: ACAGGAGCAGATGTACAG 253 Reverse: GTGATCATCCTCTCGTCTCT CCR3 Exon1 (238-780) Forward: CAGGAGGCTCCGAATTATGA 180 Reverse: ACTATGGTCTCGTGACTACC CCR4 Exon2 (118-660) Forward: CCACGGATATAGCAGACACC 450 Reverse: GAACTCCTCGGACATCTCAA CCR5 Exon2 (58-346) Forward: GGCTGAAGAGCATGACTGAC 403 Reverse: GATGGACGAGTTGGACCGGT Table 2--Concentration of purified UL128 protein.
Activation of CCR1 and CCR5 in inflammatory cells by CCL3 induces pro-inflammatory activities, such as chemotactic migration and inflammatory mediator generation.
Results from the CARAT-2 study have demonstrated clinical proof-of-concept of CCR1 inhibition in the treatment of RA," stated Thomas J.
51) Therefore, CCR1 might simply have been the wrong target in MS.
The [3-68] variant form of RANTES was subsequently found to also inhibit HIV to the same degree but to lack the same binding affinity to the CCR1 receptor.
Pharmacopeia's most advanced internal programs are: dual angiotensin (AT1) and endothelin (ETA) receptor antagonists (DARA) (for cardiovascular disease); JAK3 inhibitors (immunomodulators for multiple potential indications, including transplant rejection, psoriasis and rheumatoid arthritis); CCR1 antagonists (with potential application in the treatment of inflammatory diseases such as rheumatoid arthritis and multiple sclerosis); and adenosine A2A antagonists (with potential application in neurodegenerative diseases, including Parkinson's and Alzheimer's).
CCR3 and CCR5 but not CCR1 expressions are unregulated in cerebellum and cerebrum of CM tissue samples.
Expression of mRNA was analyzed by reverse transcriptase-polymerase chain reaction (RT-PCR) for the following: CXCL10, CCL3, CCL4, CCL5, CCR1, CCR4, CCR5, CXCR3 and [beta]-actin.
4] Human genes: RPLPO, ribosomal protein, large, P0; PPIA, peptidylprolyl isomerase A (cyclophilin A); TNFRSF1A, tumor necrosis factor receptor superfamily, member 1A; CCL11, CCL17, CCL19, CCL22, CCL3, CCL4, chemokine (C-C motif) ligand 11, 17, 19, 22, 3, and 4; CL5 chemokine (C-C motif) ligand 5; CCR1, CCR7, CCR8, chemokine (C-C motif) receptor 1, 7, and 8; CD86, CD86 molecule; CXCL12, chemokine (C-X-C motif) ligand 12 (stromal cell-derived factor 1); CXCL2, chemokine (C-X-C motif) ligand 2; CXCR4, chemokine (C-X-C motif) receptor 4; L128, interleukin 12B (natural killer cell-stimulating factor 2, cytotoxic lymphocyte maturation factor 2, p40); IL15, IL4, IL8, interleukin 15, 4, and 8; HPRT1, hypoxanthine phosphoribosyltransferase 1; PGK1, phosphoglycerate kinase 1.