CCL1


Also found in: Dictionary, Thesaurus, Encyclopedia, Wikipedia.

CCL1

A gene on chromosome 17q12 that encodes a protein structurally related to the CXC subfamily of cytokines, which are characterised by two cysteines separated by a single amino acid. CCL1 is secreted by activated T cells and is chemotactic for monocytes but not neutrophils; it binds to chemokine receptor CCR8.
Mentioned in ?
References in periodicals archive ?
In cutaneous post-capillary venules, T cell rolling, integrin activation and cell adhesion are regulated by PSGL-1-selectins interactions, chemokines including CCL1 and CCL17, and LFA1-ICAM-1 interactions, respectively.
size (bp) CXCR3 2 F: GAAAGCAGTGTGGACATAGCCA 101 R: CGGAACTTGACACCCACAAAG CCL1 19 F: AGGCTGGATCTGCTCCCAAAT 152 R: GGTGATGTGTGCAAGTTCACCA GAPDH 5 F: CTCCCAACGTGTCTGTTGTG 222 R: TGAGCTTGACAAAGTGGTCG
Seven genes (IL16, CCL1, EEF1G, CD84, MCL1, NFATC4 and IER-5) did not reveal any significant difference between Tharparkar and Vrindavani.
In the part of up and different stages of immune responses in both chicken down regulated genes differentially expressed, TLR5, groups, while CCL1, IL8, CD79B and CCL5 were THBS1, KIT, and FGF10 were identified to be up-regulated identified to be down-regulated, and are shown in Table 2 and 3.