BECN1

BECN1

A gene on chromosome 17q21 which encodes Beclin-1, a protein that plays a critical role in regulating autophagy, development, tumourigenesis and neurodegeneration, and is required for the abcission step in cytokinesis. It may play a role in antiviral host defense.
Mentioned in ?
References in periodicals archive ?
To investigate whether the treatment of 10 uM rapamycin in 24 h-aged IVM oocytes could affect the mRNA expression of autophagy-related genes, the expression of ATG5, BECN1, ATG7, MAP1LC3B, ATG12, GABARAP, and GABARAPL1 was quantified by real-time PCR (Figure 5C).
1 F:GAATATGAAGGCACACCACT R:AAATTGAGGCAAGAAGATCA BECN1 NM_001044530.