Printer Friendly
Dictionary, Encyclopedia and Thesaurus - The Free Dictionary
3,590,055,517 visitors served.
forum Join the Word of the Day Mailing List For webmasters
?
Dictionary/
thesaurus
Medical
dictionary
Legal
dictionary
Financial
dictionary
Acronyms
 
Idioms
Encyclopedia
Wikipedia
encyclopedia
?

Apicomplexa

   Also found in: Dictionary/thesaurus, Encyclopedia, Wikipedia 0.01 sec.
Apicomplexa
a phylum of protozoa, including the coccidia.
How to thank TFD for its existence? Tell a friend about us, add a link to this page, add the site to iGoogle, or visit webmaster's page for free fun content.
?Page tools
Printer friendly
Cite / link 		Feedback
Add definition
Mentioned in?  References in periodicals archive?   Medical browser?   Full browser?
 
It belongs to the subphylum Apicomplexa, class Sporozoa, and exists in nature in 3 forms: the oocyst (which releases sporozoites), the tissue cyst (which contains and may release bradyzoites), and the tachyzoite.
Toxoplasmosis in a Bone Marrow Transplant Patient by Weinrach, David M.; Oviedo, Angelica / Archives of Pathology & Laboratory Medicine
Besides bolstering the theory that endosymbiotic events were common in evolutionary history, the finding may have medicinal value: The protozoans belong to the group Apicomplexa, which includes the organisms responsible for malaria and toxoplasmosis.
Algal origins of a protozoan part by Mlot, Christine / Science News
EU1 Up GTTTCTGMCCCATCAGCTTGAC Down AGACAAGAGTCAATAACTCGATAAC CRYPTO Apicomplexa 65 F AACCTGGTTGATCCTGCCAGTAGTCAT R GAATGATCCTTCCGCAGGTTCACCTAC Primer Fragment Reference size, bp BAB 359 -11 GF2 GR2 EU1 362 -8 Up Down CRYPTO 1,727 -4 F R * For parasites from tick samples, no sequence could be obtained with primer set CRYPTO because such primers likely hybridize to the Nodes ricinus 18S rRNA gene and preferentially amplified this gene, probably because of its relative abundance.
Babesia sp. EU1 from roe deer and transmission within Ixodes ricinus by Bonnet, Sarah; Jouglin, Maggy; L'Hostis, Monique; Chauvin, Alain / Emerging Infectious Diseases
 
 
 
Medical Dictionary
?

Terms of Use | Privacy policy | Feedback | Copyright © 2012 Farlex, Inc.
Disclaimer
All content on this website, including dictionary, thesaurus, literature, geography, and other reference data is for informational purposes only. This information should not be considered complete, up to date, and is not intended to be used in place of a visit, consultation, or advice of a legal, medical, or any other professional.