Apicomplexa


Also found in: Dictionary, Thesaurus, Encyclopedia, Wikipedia.
Related to Apicomplexa: Ciliophora, Ciliata, Protozoa, plasmodium

A·pi·com·plex·a

(ap'i-kom-plek'să),
A phylum of the subkingdom Protozoa, which includes the class Sporozoea and the subclasses Coccidia and Piroplasmia, characterized by the presence of an apical complex.
[L. apex, pl. apicis, tip, summit, + complexus, woven together]

Apicomplexa

(ap″ĭ-kŏm-plek′să)
A phylum of the kingdom Protista (formerly a division of protozoa called Sporozoa); named for a complex of cell organelles (apical microtubule complex) at the apex of the sporozoite form that can penetrate host cells. It includes the medically important genera Plasmodium, Toxoplasma, Cryptosporidium, and Isospora.

Apicomplexa

a phylum of protozoa, including the coccidia.
References in periodicals archive ?
Es provocada por Neospora caninum, protozoario Apicomplexa cuyo ciclo de vida depende de los canidos, sus hospedadores definitivos, y de distintas especies intermediarias entre los que se destacan los bovinos por su mayor susceptibilidad.
cgi) analyses based on the entire sequence was Colpodella tetrahymenae (89% identity), a member of a genus that is closely related to Apicomplexa but that has never, to our knowledge, been found to infect animals or people (GenBank accession no.
EU1 Up GTTTCTGMCCCATCAGCTTGAC Down AGACAAGAGTCAATAACTCGATAAC CRYPTO Apicomplexa 65 F AACCTGGTTGATCCTGCCAGTAGTCAT R GAATGATCCTTCCGCAGGTTCACCTAC Primer Fragment Reference size, bp BAB 359 -11 GF2 GR2 EU1 362 -8 Up Down CRYPTO 1,727 -4 F R * For parasites from tick samples, no sequence could be obtained with primer set CRYPTO because such primers likely hybridize to the Nodes ricinus 18S rRNA gene and preferentially amplified this gene, probably because of its relative abundance.
Evolutionary origin of Plasmodium and other Apicomplexa based on rRNA genes.
Total evidence' refutes the inclusion of Perkinsus species in the phylum Apicomplexa.
gondii is an intracellular parasite in the phylum Apicomplexa.