ATF3


Also found in: Acronyms.

ATF3

A gene on chromosome 2q32 that encodes a member of the activation transcription factor/cAMP-responsive element-binding family. The gene is induced by various signals, including those evoked by cancer cells.
References in periodicals archive ?
Hai initially discovered worse outcomes in a group of nearly 300 breast cancer patients where the ATF3 gene had been turned on.
Turning on the ATF3 gene is all about stopping the spread of cancer.
Transcription factor ATF3 links host adaptive response to breast cancer metastasis.
Primer NF[kappa]B NM_199267 5'-GTCTCAAACCAAACAGCCTCAC-3' 5'-CAGTGTCTCTTCCTCGACATGGAT-3' TNF[alpha] NM_012675 5'-GTTTCAGTTCTCAGGGTCCTA-3' 5'-CAGGATTCTGTGGCAATCTGG-3' ATF3 NM_012912 5'-CATCAGACCTGATTTCCGAGAGT-3' 5'-AACAGTTTGTAGCCAAGGACAGC-3' Gene Probe NF[kappa]B CCCCAAGCCAGCACCCCAGCCCTAT TNF[alpha] AAAGGGATGAGAAGTTCCCAAATGG ATF3 ACGCGTGCGAAAGAGCCCACCTGAAT The first primer listed is the forward primer, whereas the second primer listed in the reverse primer.
Researchers already know that ATF3 is activated, or expressed, in response to stressful conditions in all types of cells.
Under typical circumstances, turning on ATF3 can actually cause normal and benign cells to commit suicide if the cells decide that the stressors, such as irradiation and a lack of oxygen, have irrevocably damaged the cells.
This research suggests, however, that cancer cells somehow coax immune-system cells that have been recruited to the site of a tumor to express ATF3.
Though it's still unclear how, ATF3 promotes the immune cells to act erratically and give cancer an escape route from a tumor to other areas of the body.