ACTB


Also found in: Acronyms.

ACTB

A gene on chromosome 7p22 that encodes beta actin, which coexists with gamma actins as a major cytoskeletal component and mediator of internal cell motility. ACTB is also an older gene name for what is formally (per HUGO) known as ACTG1, see there.
References in periodicals archive ?
We further evaluated the integrity of cfsRNA by quantifying the amounts of the 3 different regions of ACTB and DDX4 transcripts.
Each RNA sample was reverse-transcribed in 3 reactions, each of which was divided into 3 qPCR replicates for each of 4 genes [BCL2 (B-cell CLL/lymphoma 2), ACTB, H3F3A (histone H3.
11] Human genes: GSTP1, glutathione-S-transferase pi; RARB, retinoic acid receptor [beta]; APC, adenomatous polyposis coli; ACTB, [beta]-actin; EDNRB, endothelin receptor type B; RASSF1, Ras association (RalGDS/AF-6) domain family member 1; CDKN2A, cyclin-dependent kinase inhibitor 2A (formerly p16); PSCD2, pleckstrin homology, Sec7 and coiled-coil domains 2 (formerly ARF); MGMT, O-6-methylguanine-DNA methyltransferase.
Primers of genes chosen for quantitative real-time polymerase chain reaction GenBank Gene ID Sequence (5' to 3') Amplicon accession length number (bp) NM_205518 ACTB F: CAAAGCCAACAGAGAGAAG 137 R: CATCACCAGAGTCCATCA NM_204305 GAPDH F: ACTTTGGCATTGTGGAGGGT 131 R: GGACGCTGGGATGATGTTCT NM_204848 HPRT F: CTCACAGGCTTCAACTCT 115 R: AATGACCAAGACGAGATTCT FJ977570.
114) The risk that a transitional election will create this type of post-enactment windfall can be mitigated either (1) by narrowly defining the taxpayers or transactions that are entitled to elect grandfather protection, as in the transitional elections used in the change to section 355's ACTB requirement or in the change to the treatment of gains on sale of a principal residence, or (2) by using a phased-in effective date or a delayed effective date (rather than a grandfather rule at all) as the transition relief that may be elected.
Sample validity was determined according to the instructions for use by the laboratories on the basis of the batch controls and the internal ACTB control for each sample.
In accordance with results valuated by geNorm, the frequently used reference genes ACTB and GAPDH exhibited substantial variation, and were among the three least stable genes.
F) 5'- cysteine AATGT AC AC G AC AG CCTC AC AG peptidase C-3' (reverse primer, R) ACTB Actin, beta 5-TCACCGAGCCCCGCT-3 (forward 60 primer.
We selected eight candidates of reference genes (18S, TBP, HMBS, YWHAZ, ACTB, HPRT1, GAPDH, and EEF1A2), and the differences in their expression levels in ten different tissues types (heart, liver, spleen, lung, kidney, stomach, uterus, ovaries, small intestines and muscles) of Boer goat were compared.
The expression levels of ESR1 (estrogen receptor 1; ER[alpha]), ESR2 [estrogen receptor 2 (ER beta); ER[beta]], ESRRA (estrogen related receptor alpha; ERR[alpha]), ESRRB (estrogen related receptor beta; ERR[beta]), ESRRG (estrogen related receptor gamma), and AR (androgen receptor) genes were then assessed relative to the endogenous control genes GUSB (glucuronidase, beta) and ACTB (actin, beta; ([beta]-actin) on the TaqMan Low Density Array (TLDA) platform (Applied Biosystems, Foster City, CA, USA).
The reaction parameters were as follows: ERP29, PSMB6, ALDOA, and PHGDH, 95 C 3 min, 95[degrees]C 30 s, 51[degrees]C 30 s, 72[degrees]C 30 s for 45 cycles, 72[degrees]C extension 30 s; ECH1 and TPI1, 95[degrees]C 3 min, 95[degrees]C 30 s, 52[degrees]C 30 s, 72[degrees]C 30 s for 40 cycles, 72[degrees]C extension 30 s; PAFAH1B2, 95[degrees]C 3 min, 95[degrees]C 30 s, 52[degrees]C 10 s, 72[degrees]C 10 s for 35 cycles, 72[degrees]C extension 2 min; ACTB (encoding ( [beta] - actin, used as a control) 95[degrees]C 3 min, 95[degrees]C 30 s, 56[degrees]C 10 s, 72[degrees]C 10 s for 45 cycles, 72[degrees]C extension 2 min.
large, P0 (RPLPO) Methylation- Diverse targets Gluthione S-transferase specific pi 1 (GSTP1); retinoic PCR assay acid receptor, beta (RARB); adenomatous polyposis coli (APQ; ACTB Quantification Pathogen E.