AATA


Also found in: Acronyms, Wikipedia.

AATA

American Art Therapy Association.

AATA,

References in periodicals archive ?
The Secretary P and D told that the special initiative taken by the Chief Minister for providing sasta (subsidized) aata and ghee to 743,201 poor families of the province and of Right to information and right to services Commission had been operationalised while Public private Partnership nodes were established in 13 departments to give them autonomy.
C'est en presence du ministre de la Culture, Azzedine Mihoubi, ainsi que des ambassadeurs de Jordanie et de Tunisie, que s'est tenue cette memorable soiree poetique qui a vu la participation de cinq grands noms de la poesie egyptienne que sont le journaliste Ali Aata, Ahmed El Chahaoui directeur de publication d'Al Ahram, la psychologue Radoua Ferghali, Djamel El Kassas ancien journaliste de [beaucoup moins que] Chark El Aoussat [beaucoup plus grand que] et membre fondateur du groupe [beaucoup moins que] Eclairage poetique [beaucoup plus grand que], et Ghada Nabil, poetesse et journaliste connue sur la scene du militantisme cairote.
In response, Sharif reportedly laughed and said, " Kash vo din dubaara aata (I wish those days would come back)".
EAEC, tEPEC, and ETEC pathotypes were identified by using PCRs for known virulence determinants of each pathogen (ETEC: heat-labile and heat-stable enterotoxins; tEPEC: intimin [eae] and bundle-forming pilus; and EAEC: aatA and aaiC genes).
Singham's favourite anger expression, " Aata majhi satakli" , will be mouthed several times by Kareena instead of Ajay in the sequel.
Fragment size (bp, Locus Dye Forward Primer (5'-3') Reverse Primer (5'-3') clone) La5 NED gtcccaccaatccccactg atcctaactgcaaatgtatca- 132 ceta Lm7 VIC tctgggaggtgcacaagggaata gggggagaataaatggacaat- 259 aata Lml3 PET ccaccaatccccactgagta tccccttatagtttttcctcc- 260 tc Lml7 VIC gcagggcttgtttgaggtct gcctgctaatgctttgttgtga 171 Lm23 NED ggactctggccctggaaca agaagcctaacccaaaaagta- 202 acct Lm25 6FAM ccatgggagtcacctgcttac agtagatcagtttgtttggct- 148 tttt TABLE 3.
2012 TTCAG BIP TAAGGCCTCTTGGCCTTTGAGA- ATAATTCCAGTTAACCCACC F3 ATATTCACAGTTGGAATAGATGT B3 TGTCATGCAGACACACATC LF GTGGGAACAGCAATAATTATAGTGG LB ACAGGATTTTTATTTTTTATTTA M_B1 FIP GAATACCAATAGTCAATATAGC- In-house GTGAGGCTGGAAAATTAGAGG BIP TCATCATATATTCACAGTTGGA- TAATTATAGTGGCTGAAGTGA F3 GATTTGGAATTGTTTCTCATCT B3 TTTAATTCCTGTGGGAACAG LF ATAAATTATACCCAACCTTCCA- AATA LB AATAGATGTAGATACTCGAGCTTAT M_B2 * FIP AGAATACCAATAGTCAATATAGC- In- House GTGAGGCTGGAAAATTAGAGG BIP GTCATCATATATTCACAGTTGGA- TAATTATAGTGGCTGAAGTGA F3 GGATTTGGAATTGTTTCTCATCT B3 TTTTAATTCCTGTGGGAACAG LF ATAAATTATACCCAACCTTCCAA- ATA LB AATAGATGTAGATACTCGAGCTTAT MED J_Q FIP AGCATAAATTATCCCCAACCTTC- Adachi CTTTCTCATTTAATTAGCAGC- et al.
Us umar main toh vaise bhiyeh sab zyaada pasand aata hail' (I became a DJ because the first time I went to a club, Bollywood music was playing and I immediately felt good listening to it.
Sibel Edmonds was flabbergasted, since the ATC, the AATA, and this particular Turkish colonel were targets of interest in the intelligence she monitored for FBI Special Agent Dennis Saccher, who was in charge of the bureau's Turkish counterintelligence.
Congress ko itna gussa kyun aata hai (why is the Congress so angry)?
Global Bio-Clinical Trials 2012 will bring together 100+ regulators, heads of clinical research, clinical operations & clinical R&D, pharmacovigilance, medical affairs, clinical aata management and medical doctors from across biopharmaceutical and biosimilars companies across India and the world, to help increase awareness about the latest developments pertaining to clinical trials of bio-products.
Regulations and Guidelines for the Transportation of Research Animals are published: the AATA Manual for the Transportation of Live Animals (AATA, 2000), the IATA Live Animals Regulations (IATA, 2005), and a Report of the Transport Working Group Established by the Laboratory Animal Science Association (Swallow et al.