Printer Friendly
Dictionary, Encyclopedia and Thesaurus - The Free Dictionary
3,888,975,204 visitors served.
forum Join the Word of the Day Mailing List For webmasters
?
Dictionary/
thesaurus
Medical
dictionary
Legal
dictionary
Financial
dictionary
Acronyms
 
Idioms
Encyclopedia
Wikipedia
encyclopedia
?

ribosomal RNA
(redirected from 16S rDNA)

   Also found in: Dictionary/thesaurus, Wikipedia 0.01 sec.
RNA ribonucleic acid.
complementary RNA  (cRNA) viral RNA that is transcribed from negative-sense RNA and serves as a template for protein synthesis.
heterogeneous nuclear RNA  (hnRNA) a diverse group of long primary transcripts formed in the eukaryotic nucleus, many of which will be processed to mRNA molecules by splicing.
messenger RNA  (mRNA) RNA molecules, usually 400 to 10,000 bases long, that serve as templates for protein synthesis (translation).
negative-sense RNA  viral RNA with a base sequence complementary to that of mRNA; during replication it serves as a template for the transcription of viral complementary RNA.
positive-sense RNA  viral RNA with the same base sequence as mRNA; during replication it functions as mRNA, serving as a template for protein synthesis.
ribosomal RNA  (rRNA) that which together with proteins forms the ribosomes, playing a structural role and also a role in ribosomal binding of mRNA and tRNAs.
small nuclear RNA  (snRNA) a class of eukaryotic small RNA molecules found in the nucleus, usually as ribonucleoproteins, and apparently involved in processing heterogeneous nuclear RNA.
transfer RNA  (tRNA) 20 or more varieties of small RNA molecules functioning in translation; each variety carries a specific amino acid to a site specified by an RNA codon, binding to amino acid, ribosome, and to the codon via an anticodon region.
Enlarge picture
Schematic diagram of features common to transfer RNA molecules, depicting the anticodon and amino acid attachment regions. Dotted lines between chains represent hydrogen-bonded base pairs. The characteristic cloverleaf is formed by the hairpin and loop structures that result from intrachain hydrogen bonding.

ribosomal RNA
n.
See rRNA.

ribosomal RNA (rRNA)
[rī′bōsō′məl]
the ribonucleic acid of ribosomes and polyribosomes.

RNA 
messenger RNA (mRNA) see ribonucleic acid.
ribosomal RNA (rRNA) see ribonucleic acid.
transfer RNA (tRNA) see ribonucleic acid.

ribosomal RNA (rī´bōsō´ml),
n a type of protein-containing ribonucleic acid produced by the nucleolus and found connected to the endoplasmic reticulum or moving freely within the cytoplasm.

ribosomal RNA
Molecular biology Any of a family of single-stranded nucleic acids ranging from 100 to 3000 bases in length, that assemble in heteromultimeric complexes with proteins, to form ribosomes, the 'docking stations' for mRNA and nascent polypeptide strands. See Ribosome, RNA. Cf mRNA, tRNA.


Want to thank TFD for its existence? Tell a friend about us, add a link to this page, add the site to iGoogle, or visit the webmaster's page for free fun content.
?Page tools
Printer friendly
Cite / link
Feedback
Add definition
Mentioned in?  References in periodicals archive?   Medical browser?   Full browser?
 
Haake, (2005) Rapid, species-specific detection of uropathogen 16S rDNA and rRNA at ambient temperature by dot-blot hybridization and an electrochemical sensor array, Mol.
16S rDNA from the extracted DNA samples was PCR--amplified using the universal eubacterial primers 8Fhex (5'AGAGTTTGATCCTGGCTCAG) and 1392R (3'ACGGGCGGTGTGTRC) (Invitrogen Life Technologies, Carlsbad, California).
 
 
 
Medical Dictionary
?

Terms of Use | Privacy policy | Feedback | Advertise with Us | Copyright © 2012 Farlex, Inc.
Disclaimer
All content on this website, including dictionary, thesaurus, literature, geography, and other reference data is for informational purposes only. This information should not be considered complete, up to date, and is not intended to be used in place of a visit, consultation, or advice of a legal, medical, or any other professional.