ribosomal RNA

(redirected from 16S rDNA)
Also found in: Dictionary, Wikipedia.

RNA

 
messenger RNA (mRNA) see ribonucleic acid.
ribosomal RNA (rRNA) see ribonucleic acid.
transfer RNA (tRNA) see ribonucleic acid.

ri·bo·som·al RNA

the RNA of ribosomes and polyribosomes.

ribosomal RNA

n. Abbr. rRNA
The RNA that is a permanent structural part of a ribosome.

ribosomal RNA (rRNA)

[rī′bōsō′məl]
the ribonucleic acid of ribosomes and polyribosomes.

ribosomal RNA

Molecular biology Any of a family of single-stranded nucleic acids ranging from 100 to 3000 bases in length, that assemble in heteromultimeric complexes with proteins, to form ribosomes, the 'docking stations' for mRNA and nascent polypeptide strands. See Ribosome, RNA. Cf mRNA, tRNA.

ribosomal RNA (rRNA)

Ribonucleic acid that is a permanent structural feature of RIBOSOMES.

ribosomal RNA (rRNA)

a form of RNA transcribed from DNA in the NUCLEOLI of EUKARYOTE cells or clustered ribosomal genes in PROKARYOTES, that complexes with various proteins (r proteins) to form the RIBOSOME. rRNA constitutes the major proportion of RNA in cells and occurs in a number of different types (for example, in bacterial ribosomes: 23S rRNA, 16S rRNA and 5S rRNA). In protein synthesis a sequence near the 3′-end of the 16S rRNA interacts with the SHINE-DALGARNO sequence to initiate TRANSLATION. Certain regions of rRNA have been highly conserved during evolution and comparative sequencing studies of rRNAs are used to determine evolutionary relationships between organisms and to construct PHYLOGENETIC TREES.

ribosomal RNA (rī´bōsō´məl),

n a type of protein-containing ribonucleic acid produced by the nucleolus and found connected to the endoplasmic reticulum or moving freely within the cytoplasm.
References in periodicals archive ?
Sequencing of 16S rDNA not only is a useful technology for identification and phylogenetic analysis of bacteria but also may lead to the discovery of previously uncharacterized species.
Phylogenetic relationships of Thiomicrospira species and their identification in deep-sea hydrothermal vent samples by denaturing gradient gel electrophoresis of 16S rDNA fragments.
Strain JK7 was found by 16S rDNA sequence alignment to be closely related to the Bacillus genus, with the highest similarity with Bacillus licheniformis ATCC14580 (99%).
In conclusion, overall performance of broad-range 16S rDNA PCR was found to be promising as a screening test for diagnosis of acute bacterial meningitis, particularly in a hospital setting where most of the patients are on antibiotic.
Because so many cases occurred in immunocompromised patients, we recommend use of broad-range 16S rDNA PCR to detect L.
The fragment of 16S rDNA was amplified using the F27/R1492 primer set (Lane 1991) in 50 [micro]L reaction mixture, containing 5 [micro]L 10 X PCR buffer, 4 [micro]L template, 250 [micro]M dNTP, 1.
The nucleotide sequences for the 16S rDNA described in this report were deposited with GenBank under accession nos.
Biochemical and biological properties as well as 16S rDNA sequences of the selected isolates were considered to identify the taxonomy of the strains.
invitrogen and applied biosystems are now life technologies applied biosystems kits consumables and accessories for the abi 7500 and abi 7900 real-time pcr instruments and the abi 3100 genetic analyzer namely ambion extraction kit abi one-step rt-pcr kit ambion pcr kit abi 7900 ht and abi 7500 fast plates sealers calibration kits sealer applicators abi 3100/3500 fast microseq 500 16s rdna pcr kit with quick reference card and protocol 100 rxns 4370653 abi microseq listeria abi microseq salmonella and other microseq identification system kits abi microseq 500 16s rdna bacterial identification sequencing kit 110 rxns.
Culture-independent techniques include temperature/denaturing gradient gel electrophoresis (TGGE/DGGE), fluorescent in situ hybridization (FISH), dot blot, and 16S rDNA clone libraries (Pryor, G.
The Human Microbiome Project and metagenomic analysis, previously stymied by the requirement for large-scale sequencing of complex microbial communities, was unblocked by applications of 454 and Illumina platforms in 16S rDNA and shotgun sequencing, respectively.
Bacterial 16S rDNA was amplified from the extracted genomic DNA by using the following 16S rRNA primers: forward 8F primer 5'AGAGTTTGATCCTGGCTCAG 3' and reverse1492R primer 5' CGGCTACCTTGTTACGACTT 3' (Babu et al.